View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18159_low_8 (Length: 441)
Name: NF18159_low_8
Description: NF18159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18159_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 7e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 295 - 423
Target Start/End: Complemental strand, 8297945 - 8297815
Alignment:
| Q |
295 |
tacaattgtgaacataactttcaagtcctatcagttctctttccatatt---tacgtctatttatcttctctcattctatcaaaacaaacagaccctttc |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8297945 |
tacaattgtgaacataactttcaagtcctatcagttctctt-ccatattatttacttctatttatcttctctcattctatcaaaacaaacagaccctttc |
8297847 |
T |
|
| Q |
392 |
ctttcccctttttaaccagtggccacacctct |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8297846 |
ctttcccctttttaaccagtggccacacctct |
8297815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 323
Target Start/End: Original strand, 18278718 - 18278761
Alignment:
| Q |
280 |
tttacctcagattactacaattgtgaacataactttcaagtcct |
323 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
18278718 |
tttacctcagattactacaattgtggacacaactttaaagtcct |
18278761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University