View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18160_high_7 (Length: 277)
Name: NF18160_high_7
Description: NF18160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18160_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 7 - 261
Target Start/End: Complemental strand, 49872126 - 49871872
Alignment:
| Q |
7 |
agtgagaagaaagttaattagaagtagtttatccaagtaccatttatagtctccagctacaaagtattcagactcgtacttgtccaaatttgcaaaattt |
106 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49872126 |
agtgataagaaagttaattagaagtagtttatctaagtaccatttatagtctccagctacaaaggattcagactcgtacttgtccaaatttgcaaaattt |
49872027 |
T |
 |
| Q |
107 |
ccagctatgggaaatagtgacaggatttattatggataagcaagcgcctttattggcagtcttgacaacgaaaacctcagctccaaaaacacaattatca |
206 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
49872026 |
ccagctatgggaagtagagacaggatttattatggataagcaaccgcctttattggcagtcttgacaacgaaaacctcagctcccaaaactcaattatca |
49871927 |
T |
 |
| Q |
207 |
tccaacaaatatccttttgtagggtctttaaatgtgtcaaggttgatgaattttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49871926 |
tccaacaaatatccttttgtagggtctttaaatgtgtcaaggttgatgaattttg |
49871872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University