View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_high_29 (Length: 334)
Name: NF18161_high_29
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 15 - 151
Target Start/End: Complemental strand, 43108752 - 43108616
Alignment:
| Q |
15 |
caaaggtaaggaggggttatagatgcaaatgatgacaaagaagccgattttatgacacgacaactttttaagaatgagtagtgatacattgatcatccat |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43108752 |
caaaggtaaggaggagttatagatgcaaatgatgacaaagaagctgattttacgacacaacaactttttaagaatgagtagtgatacattaatcatccat |
43108653 |
T |
|
| Q |
115 |
gcggtaaactctccattctatacttcaatgtgacatt |
151 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
43108652 |
gcggtaaactcttcattctacacttcaatgtgacatt |
43108616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 316
Target Start/End: Complemental strand, 43108534 - 43108455
Alignment:
| Q |
237 |
atatgaaatatgattatgagnnnnnnntggtgtcggtccataattatcctttaaaaatcagcaaagaaaattgaagatta |
316 |
Q |
| |
|
|||||||||||||||||||| || |||| ||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43108534 |
atatgaaatatgattatgagaaaaaaatgatgtcagtctataattatcctttaaaaatcaacaaagaaaattgaagatta |
43108455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University