View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18161_high_35 (Length: 315)

Name: NF18161_high_35
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18161_high_35
NF18161_high_35
[»] scaffold0328 (1 HSPs)
scaffold0328 (18-304)||(15238-15524)
[»] chr8 (1 HSPs)
chr8 (141-245)||(27338094-27338198)


Alignment Details
Target: scaffold0328 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0328
Description:

Target: scaffold0328; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 15524 - 15238
Alignment:
18 agggatggcttatatatacatatggtgaatgatacttttgccttagatttagaatttcttgtcaaattcttgtgataagattatcattcatccagagcaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15524 agggatggcttatatatacatatggtgaatgatacttttgccttagatttagaatttcttgtcaaattcttgtgataagattatcattcatccagagcaa 15425  T
118 acaattctagaaaggaaagatggcttcattttcagtggaagaattcattggaaatggaattttgaaagaactcttccaaaaattgttggaagaaggctgg 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
15424 acaattctagaaaggaaagatggcttcattttcagtggaagaattcattggaaatggaattttgaaagaactcttccaaaaattgttggaagaaggttgg 15325  T
218 gatgatgtaccaacactaaaggttatgggttcagaggacatggacttgctatacatgacacagaagcaaaaggttggtcatcatcat 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15324 gatgatgtaccaacactaaaggttatgggttcagaggacatggacttgctatacatgacacagaagcaaaaggttggtcatcatcat 15238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 141 - 245
Target Start/End: Complemental strand, 27338198 - 27338094
Alignment:
141 cttcattttcagtggaagaattcattggaaatggaattttgaaagaactcttccaaaaattgttggaagaaggctgggatgatgtaccaacactaaaggt 240  Q
    ||||||||||| | |||||||| || ||||||||| ||||||| || ||  |||  ||||||||||| ||||| ||||||||||| |||||| | |||||    
27338198 cttcattttcaatagaagaatttataggaaatggagttttgaaggagctgctcccgaaattgttggatgaaggttgggatgatgtgccaacaatgaaggt 27338099  T
241 tatgg 245  Q
    |||||    
27338098 tatgg 27338094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University