View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_high_37 (Length: 290)
Name: NF18161_high_37
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 15380378 - 15380647
Alignment:
| Q |
1 |
aataaaacctgcaaagaaatgctactgaagccaagggttcccatgggactttattaccggaaactcaaattcaatatcaatgaatcagagccgttgaggt |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15380378 |
aataaaacttgcaaagaaatgctactgaaaccaagggttcccatgggactttattaccggaaactcaaattcaatatcgatgaatcagagccgttgaggt |
15380477 |
T |
 |
| Q |
101 |
actaccactgcgaggacaagacttgcaaaattgaaaataggtattgtgtgagcttcttcaggaatcaaaaatgtatctgtagaaaattattgaaccaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380478 |
actaccactgcgaggacaagacttgcaaaattgaaaataggtattgtgtgagcttcttcaggaatcaaaaatgtatctgtagaaaattattgaaccaaga |
15380577 |
T |
 |
| Q |
201 |
aagtttcgtaaattccctaaaaggaattgaagaaagcggttttgtcaagcaaacttcaacttttatcgtt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15380578 |
aagtttcgtaaattccctaaaaggaattgaagaaagcggttttgtcaaggaaacttcaacttttatcgtt |
15380647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 112 - 185
Target Start/End: Complemental strand, 24150996 - 24150923
Alignment:
| Q |
112 |
gaggacaagacttgcaaaattgaaaataggtattgtgtgagcttcttcaggaatcaaaaatgtatctgtagaaa |
185 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||| ||||| ||||||| |||||| ||| |||| |
|
|
| T |
24150996 |
gaggacaattcttgcaaaattgaaaacaggacttgtgtgagcttattcagaaatcaaacatgtatttgtggaaa |
24150923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University