View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_high_43 (Length: 251)
Name: NF18161_high_43
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36984412 - 36984174
Alignment:
| Q |
1 |
tttgaaagcaaagaagctaaaaatctacaaggccaaagaggaggtgaaacagaagaattttagcaataggttaaattctgatgttgagaatggaggtggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36984412 |
tttgaaagcaaagaagctaaaaatctacaaggccaaagaggaggtgaaacaggagaattttagcaataagttaaattctgatgttgagaatggaggtggt |
36984313 |
T |
 |
| Q |
101 |
attgttaacaacaggttgaagggaccagtaaggatgcaaaagctccatttcataggacccacaccttctccacaagctctcagtggaccaacacctttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36984312 |
attgttaacaacaggttgaagggaccagtaaggatgcaaaagctccatttcataggacccacaccttctccacaagctctcagtggaccaacacctttcg |
36984213 |
T |
 |
| Q |
201 |
gtggaccaacatcatccccaataagagttccattttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36984212 |
gtggaccaacatcatccccaataagagttccattttcat |
36984174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 12 - 95
Target Start/End: Complemental strand, 36978900 - 36978817
Alignment:
| Q |
12 |
agaagctaaaaatctacaaggccaaagaggaggtgaaacagaagaattttagcaataggttaaattctgatgttgagaatggag |
95 |
Q |
| |
|
||||||| || ||||| || ||||||||||||||||||||||| || ||||||||| ||| ||||| ||||| ||| ||||| |
|
|
| T |
36978900 |
agaagctgaacatctatcagtccaaagaggaggtgaaacagaaggatgttagcaataagttcaattccaatgttaagagtggag |
36978817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University