View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_high_54 (Length: 201)
Name: NF18161_high_54
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 24 - 111
Target Start/End: Complemental strand, 43993698 - 43993611
Alignment:
| Q |
24 |
ttaacaaattacatcaccgaaattttaagttaattgaataaattaagcagtgattaaattcaaacaaatcgaaatgggaatgtttcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43993698 |
ttaacaaattacatcaccgaaattttaagttaattgaataaattaagcagtgtttaaattcaaacaaatcgaaatgggaatgtttcaa |
43993611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 43993547 - 43993511
Alignment:
| Q |
149 |
ccatttcttttttgagttgacaacgtggaggaagatg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43993547 |
ccatttcttttttgagttgacaacgtggaggaagatg |
43993511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University