View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_low_13 (Length: 453)
Name: NF18161_low_13
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 42293123 - 42292936
Alignment:
| Q |
32 |
ctttggtaatgtttaggaaaagaataaaagtattaattaccttgtggctaggccttcacgattgcctccatccccaatggtaatatgcactggaccacaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42293123 |
ctttggtaatgtttaggaaaagaataaaagtattaattaccttgtggctaggccttcacgattgcctccatccccaatggtaatatgcactggaccacaa |
42293024 |
T |
 |
| Q |
132 |
ttgtcacctttatctttataaacccgtgtctaagaaaatnnnnnnngaataattagtatgtgagtgagtgagttatctgcattgtgatttcaacc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
42293023 |
ttgtcacctttatctttataaacccgtgtctaagaaaat---aaaagaataattagtat----gtgagtgagttatctgcatcgtgatttcaacc |
42292936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 350 - 438
Target Start/End: Complemental strand, 42292882 - 42292794
Alignment:
| Q |
350 |
cttacaaagcgttcgtaggcatgaacatgccctgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcat |
438 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292882 |
cttacaaagcgttcgtatgcatgaacatgccctgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcat |
42292794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University