View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18161_low_14 (Length: 440)

Name: NF18161_low_14
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18161_low_14
NF18161_low_14
[»] chr2 (91 HSPs)
chr2 (187-430)||(1530044-1530287)
chr2 (269-430)||(1515896-1516057)
chr2 (1-159)||(38005352-38005511)
chr2 (5-158)||(18902528-18902682)
chr2 (5-159)||(7747228-7747383)
chr2 (11-159)||(41220595-41220744)
chr2 (5-158)||(41031904-41032057)
chr2 (5-159)||(8410085-8410240)
chr2 (5-158)||(10026614-10026768)
chr2 (1-157)||(12864174-12864331)
chr2 (1-157)||(38962713-38962870)
chr2 (1-159)||(2528338-2528497)
chr2 (9-159)||(22593093-22593242)
chr2 (5-146)||(331455-331597)
chr2 (10-158)||(25540402-25540551)
chr2 (5-156)||(10046477-10046628)
chr2 (20-159)||(10823029-10823169)
chr2 (43-159)||(12455303-12455419)
chr2 (5-158)||(3643885-3644039)
chr2 (5-158)||(44139438-44139592)
chr2 (1-157)||(6358150-6358307)
chr2 (1-141)||(45263682-45263823)
chr2 (5-152)||(7787010-7787158)
chr2 (5-157)||(2550822-2550975)
chr2 (1-157)||(21286394-21286551)
chr2 (19-159)||(34346284-34346425)
chr2 (1-159)||(3811688-3811847)
chr2 (1-155)||(34356156-34356311)
chr2 (1-159)||(37560123-37560282)
chr2 (5-151)||(39201513-39201660)
chr2 (5-157)||(33005706-33005858)
chr2 (1-158)||(28616377-28616536)
chr2 (5-159)||(44945548-44945702)
chr2 (10-159)||(13026408-13026558)
chr2 (5-157)||(9360747-9360900)
chr2 (13-157)||(16034899-16035044)
chr2 (1-157)||(19976806-19976963)
chr2 (5-157)||(35946693-35946845)
chr2 (1-157)||(39806884-39807041)
chr2 (5-124)||(15079437-15079557)
chr2 (1-158)||(11069828-11069986)
chr2 (5-156)||(20612534-20612688)
chr2 (1-126)||(21180344-21180470)
chr2 (1-158)||(29422165-29422323)
chr2 (5-146)||(42770661-42770803)
chr2 (1-157)||(14169608-14169765)
chr2 (57-158)||(16325602-16325703)
chr2 (5-152)||(10669546-10669694)
chr2 (1-139)||(24179521-24179657)
chr2 (2-157)||(29697475-29697630)
chr2 (8-138)||(29653584-29653714)
chr2 (1-146)||(20963120-20963265)
chr2 (5-146)||(37804901-37805043)
chr2 (1-157)||(18649025-18649182)
chr2 (1-159)||(34722631-34722789)
chr2 (1-102)||(14853421-14853523)
chr2 (48-157)||(3848913-3849022)
chr2 (20-159)||(15234058-15234198)
chr2 (72-159)||(20116609-20116696)
chr2 (74-157)||(44773287-44773370)
chr2 (58-159)||(28525452-28525554)
chr2 (33-157)||(27725922-27726047)
chr2 (1-107)||(2149243-2149351)
chr2 (73-159)||(13104822-13104908)
chr2 (4-123)||(25549681-25549801)
chr2 (26-156)||(2784908-2785038)
chr2 (1-145)||(16813176-16813320)
chr2 (1-145)||(16852455-16852599)
chr2 (1-78)||(23500760-23500837)
chr2 (82-159)||(26805328-26805405)
chr2 (5-108)||(40968963-40969067)
chr2 (81-156)||(21641981-21642056)
chr2 (1-159)||(34130299-34130456)
chr2 (1-127)||(41187799-41187926)
chr2 (106-159)||(44548721-44548774)
chr2 (74-157)||(18846220-18846303)
chr2 (5-156)||(29802765-29802916)
chr2 (82-157)||(34420235-34420310)
chr2 (49-112)||(43303336-43303399)
chr2 (105-159)||(13514048-13514102)
chr2 (49-111)||(25604594-25604655)
chr2 (1-43)||(26805264-26805306)
chr2 (11-112)||(31596476-31596578)
chr2 (104-157)||(792208-792261)
chr2 (51-111)||(29421285-29421343)
chr2 (48-133)||(41187707-41187792)
chr2 (75-154)||(31740763-31740842)
chr2 (126-159)||(29299354-29299387)
chr2 (93-146)||(31088377-31088430)
chr2 (85-156)||(36480438-36480506)
chr2 (46-122)||(33634473-33634549)
[»] chr6 (51 HSPs)
chr6 (5-159)||(21898606-21898761)
chr6 (5-158)||(5253221-5253375)
chr6 (5-158)||(10311467-10311621)
chr6 (5-158)||(13036002-13036156)
chr6 (5-159)||(29444762-29444917)
chr6 (1-159)||(8611971-8612130)
chr6 (1-157)||(29333138-29333294)
chr6 (16-159)||(12606399-12606543)
chr6 (13-159)||(6606094-6606241)
chr6 (5-159)||(13468891-13469046)
chr6 (1-159)||(14107355-14107514)
chr6 (1-146)||(34954629-34954774)
chr6 (1-159)||(8932615-8932774)
chr6 (1-159)||(8944081-8944240)
chr6 (12-159)||(30788850-30788996)
chr6 (1-159)||(3587942-3588101)
chr6 (5-159)||(19089456-19089611)
chr6 (5-158)||(3601042-3601196)
chr6 (1-139)||(19230576-19230713)
chr6 (1-145)||(9179747-9179892)
chr6 (73-159)||(9633622-9633708)
chr6 (26-159)||(12635793-12635927)
chr6 (1-157)||(8938665-8938822)
chr6 (5-146)||(2271313-2271453)
chr6 (1-123)||(9147255-9147378)
chr6 (54-159)||(5029825-5029930)
chr6 (70-158)||(31129201-31129289)
chr6 (5-135)||(9366445-9366575)
chr6 (9-159)||(13584443-13584597)
chr6 (1-156)||(11142557-11142713)
chr6 (5-119)||(21016788-21016903)
chr6 (81-159)||(14783417-14783495)
chr6 (5-146)||(15643844-15643980)
chr6 (86-158)||(30410485-30410557)
chr6 (34-156)||(8149797-8149918)
chr6 (94-159)||(14326045-14326110)
chr6 (94-159)||(14419055-14419120)
chr6 (5-145)||(17114908-17115049)
chr6 (5-121)||(24671901-24672018)
chr6 (1-146)||(8888836-8888982)
chr6 (48-157)||(13391289-13391397)
chr6 (49-157)||(33859318-33859426)
chr6 (71-156)||(32157167-32157252)
chr6 (1-80)||(3030694-3030774)
chr6 (5-64)||(5759586-5759646)
chr6 (72-138)||(5333030-5333096)
chr6 (5-113)||(21945247-21945356)
chr6 (1-101)||(32048405-32048506)
chr6 (77-141)||(7300200-7300264)
chr6 (3-104)||(10312699-10312801)
chr6 (69-122)||(10396496-10396549)
[»] chr5 (93 HSPs)
chr5 (5-159)||(5731917-5732072)
chr5 (1-159)||(41163457-41163615)
chr5 (5-159)||(42086282-42086437)
chr5 (1-159)||(1538382-1538541)
chr5 (5-159)||(19572679-19572834)
chr5 (1-159)||(9812823-9812982)
chr5 (4-157)||(25417182-25417336)
chr5 (1-159)||(12704965-12705124)
chr5 (1-159)||(12766082-12766241)
chr5 (1-159)||(30349530-30349689)
chr5 (5-158)||(8513474-8513628)
chr5 (1-158)||(23383599-23383766)
chr5 (48-159)||(9805003-9805114)
chr5 (1-159)||(42861215-42861374)
chr5 (15-159)||(13664225-13664370)
chr5 (5-156)||(20525793-20525945)
chr5 (5-158)||(7866536-7866690)
chr5 (45-159)||(38897716-38897829)
chr5 (5-113)||(28857083-28857192)
chr5 (1-159)||(4016252-4016411)
chr5 (5-158)||(20682615-20682770)
chr5 (1-159)||(18136273-18136436)
chr5 (44-158)||(40117410-40117524)
chr5 (14-157)||(11845800-11845944)
chr5 (14-137)||(30995085-30995209)
chr5 (5-156)||(37263196-37263347)
chr5 (1-159)||(5079282-5079440)
chr5 (1-159)||(39728338-39728497)
chr5 (1-157)||(2485148-2485304)
chr5 (1-133)||(7308387-7308520)
chr5 (5-145)||(35561829-35561970)
chr5 (1-158)||(14728033-14728192)
chr5 (1-146)||(18294494-18294639)
chr5 (2-98)||(1898953-1899050)
chr5 (13-157)||(14588616-14588761)
chr5 (1-157)||(20692884-20693041)
chr5 (1-133)||(26077092-26077225)
chr5 (70-159)||(39099776-39099865)
chr5 (1-159)||(3653911-3654068)
chr5 (1-159)||(23247349-23247507)
chr5 (1-107)||(35403561-35403668)
chr5 (1-159)||(41800928-41801087)
chr5 (9-158)||(9168251-9168399)
chr5 (1-158)||(20255320-20255478)
chr5 (56-157)||(24463885-24463986)
chr5 (43-156)||(42291505-42291618)
chr5 (27-158)||(12081885-12082017)
chr5 (11-146)||(15034037-15034172)
chr5 (16-137)||(14974343-14974465)
chr5 (43-159)||(18262615-18262731)
chr5 (1-119)||(14152001-14152120)
chr5 (1-107)||(38297013-38297120)
chr5 (102-158)||(28857002-28857058)
chr5 (70-158)||(43399149-43399237)
chr5 (1-159)||(24498934-24499092)
chr5 (9-155)||(28862784-28862931)
chr5 (69-158)||(7616940-7617029)
chr5 (1-97)||(25950641-25950738)
chr5 (5-64)||(6767143-6767203)
chr5 (14-159)||(17693337-17693476)
chr5 (8-157)||(18045597-18045746)
chr5 (47-137)||(21149732-21149822)
chr5 (44-158)||(38369695-38369808)
chr5 (82-151)||(6764462-6764531)
chr5 (4-159)||(18327724-18327870)
chr5 (5-73)||(28856932-28857001)
chr5 (1-133)||(35813021-35813154)
chr5 (47-156)||(21487615-21487721)
chr5 (43-158)||(24653810-24653924)
chr5 (115-158)||(28857212-28857255)
chr5 (47-137)||(7336618-7336708)
chr5 (49-159)||(21375352-21375461)
chr5 (48-122)||(35006769-35006843)
chr5 (71-145)||(35245017-35245091)
chr5 (5-97)||(16755016-16755109)
chr5 (49-146)||(20228717-20228814)
chr5 (70-159)||(20590020-20590109)
chr5 (82-158)||(22295249-22295325)
chr5 (73-145)||(24875369-24875441)
chr5 (56-159)||(22655155-22655257)
chr5 (1-44)||(25510438-25510481)
chr5 (14-146)||(20223020-20223150)
chr5 (69-159)||(25452945-25453034)
chr5 (58-112)||(25467419-25467473)
chr5 (60-146)||(32874798-32874884)
chr5 (47-136)||(20705561-20705650)
chr5 (48-97)||(40060295-40060344)
chr5 (49-145)||(19839327-19839423)
chr5 (93-157)||(27648424-27648488)
chr5 (91-159)||(40773315-40773383)
chr5 (1-123)||(35638066-35638189)
chr5 (102-159)||(36783296-36783353)
chr5 (1-123)||(1826808-1826932)
[»] chr7 (73 HSPs)
chr7 (5-158)||(48804640-48804794)
chr7 (5-159)||(13095815-13095970)
chr7 (1-157)||(27028232-27028389)
chr7 (1-158)||(34659179-34659337)
chr7 (29-157)||(38578866-38578995)
chr7 (1-156)||(26423288-26423443)
chr7 (1-159)||(1605894-1606053)
chr7 (1-159)||(22973920-22974079)
chr7 (5-159)||(22993364-22993519)
chr7 (1-159)||(43861969-43862128)
chr7 (10-159)||(10047873-10048023)
chr7 (6-159)||(16802081-16802235)
chr7 (6-155)||(18785627-18785777)
chr7 (1-159)||(5069812-5069971)
chr7 (1-159)||(17748379-17748538)
chr7 (5-159)||(47341833-47341988)
chr7 (1-158)||(43346777-43346935)
chr7 (8-159)||(21530708-21530860)
chr7 (1-159)||(14650270-14650429)
chr7 (1-152)||(45960007-45960158)
chr7 (5-158)||(4195200-4195354)
chr7 (1-158)||(8734684-8734842)
chr7 (5-146)||(43925469-43925611)
chr7 (5-159)||(1797417-1797572)
chr7 (1-141)||(4228769-4228907)
chr7 (5-139)||(19914720-19914854)
chr7 (1-146)||(42032049-42032195)
chr7 (1-156)||(27875088-27875243)
chr7 (4-154)||(14535247-14535398)
chr7 (1-159)||(23658133-23658291)
chr7 (5-159)||(39420795-39420949)
chr7 (10-159)||(42210259-42210409)
chr7 (45-159)||(48244353-48244467)
chr7 (1-158)||(22268039-22268185)
chr7 (4-140)||(36619270-36619407)
chr7 (1-152)||(5039422-5039574)
chr7 (43-158)||(10317744-10317858)
chr7 (45-159)||(49142666-49142780)
chr7 (1-158)||(39474892-39475051)
chr7 (5-146)||(45447927-45448069)
chr7 (26-158)||(21190778-21190911)
chr7 (1-157)||(37514874-37515031)
chr7 (1-158)||(24969324-24969480)
chr7 (5-157)||(365097-365250)
chr7 (42-157)||(3603348-3603467)
chr7 (71-157)||(41945497-41945583)
chr7 (73-159)||(48551883-48551969)
chr7 (70-159)||(28744185-28744274)
chr7 (33-146)||(28396170-28396284)
chr7 (57-159)||(32823253-32823355)
chr7 (1-157)||(29805439-29805595)
chr7 (69-157)||(3353446-3353534)
chr7 (1-64)||(9685692-9685756)
chr7 (5-64)||(34127712-34127772)
chr7 (1-159)||(29151893-29152052)
chr7 (1-157)||(4973110-4973266)
chr7 (46-123)||(30827291-30827368)
chr7 (45-157)||(22573811-22573922)
chr7 (88-159)||(24983415-24983487)
chr7 (82-154)||(38988935-38989006)
chr7 (1-111)||(45853565-45853676)
chr7 (5-122)||(11607088-11607205)
chr7 (94-159)||(32768984-32769049)
chr7 (69-146)||(45697200-45697277)
chr7 (1-113)||(46414628-46414741)
chr7 (1-135)||(4706005-4706140)
chr7 (88-146)||(41267934-41267992)
chr7 (82-159)||(45758322-45758397)
chr7 (1-105)||(20247221-20247325)
chr7 (1-119)||(14537819-14537938)
chr7 (103-158)||(34127643-34127698)
chr7 (65-137)||(23060697-23060767)
chr7 (30-146)||(48224741-48224857)
[»] chr3 (97 HSPs)
chr3 (1-157)||(54261176-54261333)
chr3 (1-159)||(15320136-15320295)
chr3 (1-157)||(45877404-45877561)
chr3 (1-159)||(29127869-29128028)
chr3 (1-158)||(48341970-48342128)
chr3 (5-157)||(30767247-30767400)
chr3 (1-159)||(13893876-13894035)
chr3 (1-159)||(41630510-41630669)
chr3 (1-157)||(35315906-35316063)
chr3 (9-159)||(28572209-28572360)
chr3 (5-159)||(29135867-29136022)
chr3 (9-158)||(7328802-7328951)
chr3 (5-159)||(42412775-42412927)
chr3 (1-159)||(3136692-3136850)
chr3 (5-159)||(7310701-7310856)
chr3 (5-159)||(25294914-25295069)
chr3 (13-159)||(47219106-47219253)
chr3 (1-159)||(47749103-47749261)
chr3 (5-154)||(26207804-26207954)
chr3 (1-158)||(31072828-31072986)
chr3 (1-135)||(32873571-32873705)
chr3 (1-158)||(49543469-49543627)
chr3 (1-156)||(51682955-51683111)
chr3 (1-158)||(7650177-7650335)
chr3 (5-156)||(3507534-3507687)
chr3 (5-153)||(10040511-10040659)
chr3 (5-157)||(47471786-47471938)
chr3 (5-156)||(6462366-6462518)
chr3 (1-159)||(33251612-33251771)
chr3 (5-158)||(30045775-30045929)
chr3 (1-146)||(49198301-49198447)
chr3 (50-159)||(26043812-26043921)
chr3 (5-157)||(29762155-29762308)
chr3 (4-159)||(26361965-26362119)
chr3 (1-159)||(51060279-51060438)
chr3 (1-122)||(11687144-11687266)
chr3 (1-158)||(55069678-55069836)
chr3 (45-145)||(8164548-8164648)
chr3 (1-124)||(10855334-10855458)
chr3 (5-124)||(39849026-39849145)
chr3 (21-156)||(53649697-53649833)
chr3 (53-159)||(24506646-24506751)
chr3 (5-155)||(8362536-8362682)
chr3 (43-159)||(45402349-45402465)
chr3 (26-158)||(15795493-15795625)
chr3 (5-140)||(40944837-40944972)
chr3 (1-132)||(49082774-49082906)
chr3 (47-158)||(23511564-23511675)
chr3 (5-97)||(37092565-37092658)
chr3 (90-159)||(44064584-44064653)
chr3 (5-157)||(45450447-45450597)
chr3 (86-159)||(49021201-49021274)
chr3 (1-159)||(928550-928709)
chr3 (5-123)||(3755524-3755643)
chr3 (2-96)||(7612987-7613082)
chr3 (45-152)||(33688946-33689053)
chr3 (55-152)||(50405608-50405705)
chr3 (1-152)||(35923628-35923780)
chr3 (21-144)||(52364813-52364937)
chr3 (43-159)||(54237441-54237557)
chr3 (1-103)||(46529924-46530027)
chr3 (88-158)||(10043720-10043790)
chr3 (43-152)||(40660332-40660441)
chr3 (5-158)||(41219547-41219700)
chr3 (86-159)||(43330730-43330803)
chr3 (82-158)||(2668093-2668169)
chr3 (26-157)||(19146936-19147068)
chr3 (70-141)||(7648760-7648831)
chr3 (101-159)||(36043672-36043730)
chr3 (68-157)||(13367442-13367531)
chr3 (26-159)||(19873344-19873481)
chr3 (9-124)||(28242236-28242352)
chr3 (56-155)||(4638160-4638259)
chr3 (55-158)||(26590265-26590368)
chr3 (1-79)||(33560810-33560889)
chr3 (14-103)||(13167497-13167591)
chr3 (43-157)||(22909777-22909890)
chr3 (96-158)||(47164152-47164214)
chr3 (1-146)||(52168581-52168727)
chr3 (82-159)||(34374440-34374517)
chr3 (1-159)||(35998569-35998720)
chr3 (49-157)||(20948061-20948169)
chr3 (1-80)||(30735022-30735102)
chr3 (29-156)||(34662320-34662448)
chr3 (45-156)||(2029268-2029379)
chr3 (5-123)||(47303523-47303642)
chr3 (13-79)||(52011046-52011113)
chr3 (1-70)||(10043100-10043170)
chr3 (1-146)||(22405554-22405700)
chr3 (46-156)||(25515749-25515858)
chr3 (94-159)||(29195317-29195382)
chr3 (93-158)||(50753340-50753405)
chr3 (1-113)||(6286075-6286187)
chr3 (13-145)||(24146340-24146473)
chr3 (89-146)||(32522018-32522075)
chr3 (106-146)||(8683251-8683291)
chr3 (5-92)||(11025438-11025524)
[»] chr4 (96 HSPs)
chr4 (1-159)||(53599015-53599174)
chr4 (5-158)||(24166409-24166563)
chr4 (1-158)||(38165982-38166140)
chr4 (5-158)||(47078417-47078571)
chr4 (5-158)||(55920993-55921147)
chr4 (5-157)||(29895746-29895899)
chr4 (1-158)||(52950037-52950195)
chr4 (1-158)||(5472846-5473004)
chr4 (1-157)||(2559262-2559419)
chr4 (1-156)||(13073493-13073649)
chr4 (29-158)||(3159467-3159597)
chr4 (1-157)||(14123971-14124128)
chr4 (5-123)||(1446785-1446904)
chr4 (27-157)||(7246645-7246776)
chr4 (5-157)||(27248387-27248538)
chr4 (1-159)||(1940774-1940930)
chr4 (16-159)||(38168227-38168370)
chr4 (10-157)||(42722576-42722724)
chr4 (1-151)||(8888977-8889128)
chr4 (1-158)||(6779166-6779324)
chr4 (1-158)||(15732446-15732604)
chr4 (5-156)||(33647680-33647832)
chr4 (1-156)||(40780861-40781017)
chr4 (16-159)||(49260662-49260806)
chr4 (1-155)||(295534-295688)
chr4 (27-157)||(43468328-43468459)
chr4 (1-158)||(38075388-38075546)
chr4 (1-146)||(40272341-40272487)
chr4 (5-159)||(3574445-3574598)
chr4 (9-159)||(36262764-36262913)
chr4 (55-158)||(16450310-16450413)
chr4 (10-159)||(20128273-20128423)
chr4 (10-159)||(36145212-36145362)
chr4 (1-134)||(41339417-41339551)
chr4 (5-145)||(20532420-20532561)
chr4 (5-156)||(6032643-6032792)
chr4 (1-158)||(10540971-10541128)
chr4 (8-157)||(15839934-15840083)
chr4 (44-158)||(16645117-16645231)
chr4 (5-158)||(41162880-41163034)
chr4 (5-159)||(20421733-20421887)
chr4 (1-123)||(8064831-8064953)
chr4 (26-155)||(21429281-21429411)
chr4 (1-157)||(7000479-7000631)
chr4 (70-158)||(17080068-17080156)
chr4 (56-159)||(4738629-4738732)
chr4 (5-158)||(29588695-29588849)
chr4 (1-113)||(26479992-26480105)
chr4 (5-157)||(43458572-43458725)
chr4 (1-157)||(31588639-31588798)
chr4 (27-158)||(48015071-48015203)
chr4 (82-157)||(14567276-14567351)
chr4 (1-123)||(20354592-20354715)
chr4 (13-146)||(30317200-30317334)
chr4 (69-158)||(47682380-47682469)
chr4 (26-153)||(3507251-3507378)
chr4 (5-156)||(7741884-7742036)
chr4 (1-159)||(4736552-4736710)
chr4 (1-159)||(14858666-14858824)
chr4 (48-158)||(48834698-48834807)
chr4 (69-146)||(46108715-46108792)
chr4 (5-124)||(12703577-12703697)
chr4 (74-157)||(49952144-49952228)
chr4 (49-159)||(21192646-21192754)
chr4 (58-156)||(14859304-14859402)
chr4 (73-159)||(50485971-50486057)
chr4 (73-158)||(8424582-8424667)
chr4 (1-157)||(15829654-15829811)
chr4 (1-157)||(42722378-42722534)
chr4 (1-64)||(13552069-13552133)
chr4 (5-159)||(18531478-18531633)
chr4 (1-63)||(34667695-34667758)
chr4 (5-97)||(27531717-27531809)
chr4 (70-159)||(35359761-35359850)
chr4 (99-159)||(25406560-25406620)
chr4 (82-146)||(54946286-54946350)
chr4 (1-122)||(37382500-37382622)
chr4 (5-146)||(48317285-48317427)
chr4 (44-157)||(45721085-45721198)
chr4 (43-159)||(6862223-6862337)
chr4 (13-112)||(24850671-24850770)
chr4 (44-158)||(33176013-33176127)
chr4 (73-158)||(9548739-9548824)
chr4 (1-97)||(19651504-19651601)
chr4 (15-91)||(13436783-13436858)
chr4 (82-158)||(14597898-14597974)
chr4 (16-156)||(26237422-26237561)
chr4 (1-121)||(33109277-33109400)
chr4 (45-159)||(14567959-14568067)
chr4 (83-146)||(37194848-37194911)
chr4 (86-145)||(53354573-53354632)
chr4 (71-157)||(37369041-37369127)
chr4 (1-157)||(2686454-2686611)
chr4 (69-158)||(17946513-17946602)
chr4 (4-124)||(55005338-55005459)
chr4 (74-142)||(23788426-23788494)
[»] chr1 (93 HSPs)
chr1 (1-158)||(5855473-5855631)
chr1 (1-159)||(18915818-18915977)
chr1 (1-159)||(41663854-41664013)
chr1 (5-159)||(49078069-49078224)
chr1 (16-159)||(34719742-34719886)
chr1 (1-159)||(17642002-17642161)
chr1 (5-159)||(8763946-8764101)
chr1 (5-159)||(43959819-43959974)
chr1 (4-158)||(45361881-45362036)
chr1 (1-158)||(10422739-10422897)
chr1 (1-158)||(32142845-32143002)
chr1 (1-158)||(10172970-10173128)
chr1 (5-158)||(11397888-11398041)
chr1 (7-159)||(26325769-26325922)
chr1 (8-158)||(9659178-9659328)
chr1 (4-158)||(30927726-30927881)
chr1 (1-158)||(32150921-32151079)
chr1 (5-146)||(40288488-40288630)
chr1 (16-158)||(16956432-16956575)
chr1 (5-158)||(15238105-15238259)
chr1 (1-146)||(15465916-15466062)
chr1 (44-158)||(26660133-26660246)
chr1 (1-146)||(33418126-33418272)
chr1 (1-122)||(48798105-48798227)
chr1 (10-146)||(14254279-14254416)
chr1 (26-159)||(37339795-37339930)
chr1 (1-123)||(47312933-47313055)
chr1 (5-157)||(33004015-33004168)
chr1 (20-139)||(18708558-18708678)
chr1 (1-158)||(50503360-50503518)
chr1 (1-157)||(2567227-2567384)
chr1 (6-146)||(10336472-10336613)
chr1 (1-145)||(12036756-12036901)
chr1 (5-157)||(45726433-45726586)
chr1 (1-123)||(32822-32945)
chr1 (5-158)||(2980930-2981084)
chr1 (1-157)||(5503982-5504139)
chr1 (15-159)||(34697300-34697445)
chr1 (45-157)||(16263541-16263653)
chr1 (26-157)||(18649352-18649484)
chr1 (1-159)||(892300-892454)
chr1 (5-159)||(9853275-9853430)
chr1 (1-159)||(12744521-12744680)
chr1 (1-159)||(12755511-12755670)
chr1 (1-159)||(31152667-31152825)
chr1 (5-142)||(25165357-25165493)
chr1 (54-157)||(21849205-21849307)
chr1 (5-107)||(45536664-45536766)
chr1 (5-158)||(33498838-33498992)
chr1 (1-118)||(34877941-34878059)
chr1 (14-159)||(41696596-41696741)
chr1 (5-121)||(6563396-6563513)
chr1 (82-158)||(4581681-4581757)
chr1 (19-145)||(48761145-48761272)
chr1 (14-99)||(34334353-34334439)
chr1 (9-157)||(14357714-14357863)
chr1 (44-154)||(17092480-17092590)
chr1 (1-146)||(17358482-17358628)
chr1 (1-97)||(8905211-8905307)
chr1 (1-157)||(31576547-31576704)
chr1 (54-159)||(35211170-35211275)
chr1 (46-129)||(28324608-28324691)
chr1 (46-159)||(35908754-35908866)
chr1 (5-158)||(42744742-42744881)
chr1 (72-146)||(10507721-10507795)
chr1 (73-159)||(44969688-44969774)
chr1 (5-158)||(46929737-46929890)
chr1 (70-159)||(50094925-50095014)
chr1 (1-158)||(51437420-51437566)
chr1 (77-157)||(50952261-50952341)
chr1 (5-159)||(17389727-17389881)
chr1 (5-119)||(31734244-31734358)
chr1 (88-158)||(6899597-6899667)
chr1 (45-123)||(13262079-13262157)
chr1 (20-157)||(26258666-26258803)
chr1 (54-152)||(38859121-38859219)
chr1 (74-123)||(38791644-38791693)
chr1 (71-159)||(5143152-5143239)
chr1 (5-64)||(41743228-41743288)
chr1 (1-135)||(5063866-5064000)
chr1 (5-123)||(17988694-17988812)
chr1 (74-113)||(19195391-19195430)
chr1 (101-159)||(1764195-1764253)
chr1 (1-158)||(18808216-18808374)
chr1 (1-69)||(1764277-1764346)
chr1 (49-146)||(42710149-42710246)
chr1 (47-123)||(13265936-13266012)
chr1 (71-159)||(25178574-25178662)
chr1 (100-159)||(3850740-3850799)
chr1 (73-158)||(44716214-44716299)
chr1 (1-80)||(937563-937642)
chr1 (20-111)||(2270301-2270390)
chr1 (102-158)||(47084175-47084231)
[»] scaffold0316 (1 HSPs)
scaffold0316 (5-158)||(1612-1766)
[»] scaffold0002 (4 HSPs)
scaffold0002 (5-158)||(527-681)
scaffold0002 (8-159)||(319382-319534)
scaffold0002 (14-103)||(139397-139491)
scaffold0002 (5-91)||(412091-412178)
[»] chr8 (66 HSPs)
chr8 (5-156)||(15884556-15884707)
chr8 (5-159)||(2467115-2467270)
chr8 (1-159)||(6100426-6100585)
chr8 (1-157)||(44893277-44893434)
chr8 (5-159)||(10927564-10927719)
chr8 (5-159)||(14666068-14666223)
chr8 (1-158)||(8141056-8141214)
chr8 (5-158)||(8997542-8997696)
chr8 (5-158)||(45521127-45521280)
chr8 (1-159)||(14846530-14846688)
chr8 (5-159)||(24837200-24837355)
chr8 (1-158)||(43032855-43033013)
chr8 (1-137)||(33401818-33401955)
chr8 (1-146)||(9860005-9860152)
chr8 (5-159)||(2964034-2964189)
chr8 (1-158)||(3418511-3418669)
chr8 (1-158)||(43027259-43027417)
chr8 (1-156)||(4479296-4479451)
chr8 (1-159)||(10535401-10535559)
chr8 (6-152)||(11785876-11786021)
chr8 (5-146)||(1012987-1013129)
chr8 (5-158)||(17981399-17981553)
chr8 (1-119)||(34846768-34846886)
chr8 (5-114)||(38922456-38922566)
chr8 (1-159)||(583768-583925)
chr8 (5-159)||(16893895-16894048)
chr8 (43-140)||(6042818-6042915)
chr8 (1-124)||(13085478-13085602)
chr8 (1-157)||(18373964-18374121)
chr8 (71-159)||(11298264-11298352)
chr8 (1-157)||(68097-68254)
chr8 (56-158)||(16291201-16291303)
chr8 (1-113)||(34613821-34613934)
chr8 (1-124)||(44031467-44031596)
chr8 (271-423)||(7978452-7978615)
chr8 (1-123)||(22810034-22810154)
chr8 (1-144)||(29933727-29933870)
chr8 (1-146)||(24938572-24938718)
chr8 (1-130)||(33935761-33935891)
chr8 (8-156)||(7673657-7673803)
chr8 (1-159)||(26570878-26571037)
chr8 (1-146)||(6940512-6940657)
chr8 (5-146)||(38235863-38236005)
chr8 (1-157)||(17845687-17845841)
chr8 (86-159)||(22212512-22212585)
chr8 (70-146)||(3567928-3568004)
chr8 (73-157)||(23895595-23895679)
chr8 (70-152)||(13357960-13358042)
chr8 (77-158)||(3692864-3692945)
chr8 (5-150)||(35496261-35496406)
chr8 (49-145)||(43349327-43349423)
chr8 (82-157)||(2209819-2209894)
chr8 (70-113)||(8586982-8587025)
chr8 (47-157)||(36662406-36662515)
chr8 (88-158)||(39969913-39969983)
chr8 (87-156)||(3379812-3379881)
chr8 (1-133)||(30903290-30903422)
chr8 (86-146)||(12754065-12754125)
chr8 (87-159)||(27975932-27976004)
chr8 (87-159)||(28033201-28033273)
chr8 (1-100)||(34710623-34710723)
chr8 (88-159)||(8803096-8803167)
chr8 (74-131)||(18091428-18091485)
chr8 (87-156)||(28738151-28738220)
chr8 (73-121)||(21174167-21174215)
chr8 (98-158)||(34593615-34593675)
[»] scaffold0291 (1 HSPs)
scaffold0291 (43-158)||(6851-6966)
[»] scaffold0016 (1 HSPs)
scaffold0016 (1-158)||(8699-8866)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-159)||(68470-68626)
[»] scaffold0029 (1 HSPs)
scaffold0029 (1-159)||(40997-41156)
[»] scaffold0009 (2 HSPs)
scaffold0009 (5-157)||(42831-42984)
scaffold0009 (5-156)||(9393-9551)
[»] scaffold0170 (1 HSPs)
scaffold0170 (1-146)||(9798-9944)
[»] scaffold0004 (2 HSPs)
scaffold0004 (5-159)||(94977-95131)
scaffold0004 (31-159)||(7832-7961)
[»] scaffold0209 (1 HSPs)
scaffold0209 (1-159)||(12528-12685)
[»] scaffold0010 (2 HSPs)
scaffold0010 (1-156)||(25784-25940)
scaffold0010 (58-159)||(155708-155809)
[»] scaffold0376 (1 HSPs)
scaffold0376 (5-157)||(12627-12780)
[»] scaffold0086 (1 HSPs)
scaffold0086 (5-157)||(26140-26293)
[»] scaffold0050 (1 HSPs)
scaffold0050 (19-124)||(72604-72709)
[»] scaffold0384 (1 HSPs)
scaffold0384 (5-146)||(5930-6071)
[»] scaffold0005 (4 HSPs)
scaffold0005 (5-124)||(271106-271226)
scaffold0005 (82-157)||(250024-250099)
scaffold0005 (82-158)||(219404-219480)
scaffold0005 (45-159)||(249308-249416)
[»] scaffold0001 (1 HSPs)
scaffold0001 (68-158)||(65150-65240)
[»] scaffold0341 (1 HSPs)
scaffold0341 (5-121)||(18589-18706)
[»] scaffold0223 (1 HSPs)
scaffold0223 (74-157)||(16906-16989)
[»] scaffold0079 (1 HSPs)
scaffold0079 (26-104)||(8153-8231)
[»] scaffold0332 (1 HSPs)
scaffold0332 (1-68)||(15284-15352)
[»] scaffold0041 (1 HSPs)
scaffold0041 (69-157)||(25107-25195)
[»] scaffold0011 (2 HSPs)
scaffold0011 (48-156)||(186519-186626)
scaffold0011 (87-157)||(224357-224427)
[»] scaffold0024 (1 HSPs)
scaffold0024 (70-158)||(149408-149496)
[»] scaffold0155 (1 HSPs)
scaffold0155 (70-156)||(19278-19364)
[»] scaffold0013 (1 HSPs)
scaffold0013 (51-157)||(51735-51837)
[»] scaffold0116 (1 HSPs)
scaffold0116 (86-146)||(17429-17489)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 91)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 187 - 430
Target Start/End: Original strand, 1530044 - 1530287
Alignment:
187 aatagcaatccgattataatactttggaagcccacttacaaataaaaaaccaccatatattttgaaggagttgcatctagataaatgaaagaataatttt 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  || ||||||| ||||||||||||    
1530044 aatagcaatccgattataatactttggaagcccacttacaaataaaaaaccaccatatattttgaaggagttgcacgtaaataaatggaagaataatttt 1530143  T
287 tggatcaatagatgaatgaatgtaatgttaattatatgaaacaatacattaacaaaataatcatatggaaaggaaactagttattatgatcatctttggt 386  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
1530144 tggatcaatacatgaatgaatgtaatgttaattatatgaaacaatacattaacaaaataatcatatggaaaggaaactagttagtatgatcatctttggt 1530243  T
387 tatattgtttttggccctcattctactaccccatgatgatgatg 430  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
1530244 tatattgtttttggccctcattctactaccccatgatgatgatg 1530287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 269 - 430
Target Start/End: Original strand, 1515896 - 1516057
Alignment:
269 aaatgaaagaataatttttggatcaatagatgaatgaatgtaatgttaattatatgaaacaatacattaacaaaataatcatatggaaaggaaactagtt 368  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1515896 aaatgaaagaataatttttggatcaatacatgaatgaatgtaatgttaattatatgaaacaatacattaacaaaataatcatatggaaaggaaactagtt 1515995  T
369 attatgatcatctttggttatattgtttttggccctcattctactaccccatgatgatgatg 430  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1515996 agtatgatcatctttggttatattgtttttggccctcattctactaccccatgatgatgatg 1516057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 38005352 - 38005511
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||    
38005352 ttgtttgggctccagtggcaaggagctccttccaaggacgtacccggggaatactgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcc 38005451  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||| |||||||||| |||||||||||| |||||||||||||||||||||    
38005452 tctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaagcc 38005511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 18902682 - 18902528
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||| ||| ||||||||||| ||| ||||||||| || |||||    
18902682 ttgggctccagtggcaaggagctccttccaaggacgtactcggggaataccgggttcgattcccacggggaacaacgcttgaccagtgcgcgtgtctcta 18902583  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||||||||||||| ||||||||||||||||||||| |||||||||||    
18902582 cgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 18902528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 7747228 - 7747383
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| | | | ||||||||| |||||||||| |||||||||||    
7747228 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcctaggaggaacaacgtttggccagtgtgcatgcctcta 7747327  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||| |||||||| ||||||||||||| ||||||||||||    
7747328 cgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagcc 7747383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 11 - 159
Target Start/End: Original strand, 41220595 - 41220744
Alignment:
11 tccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatg 109  Q
    |||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||||||||||    
41220595 tccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatg 41220694  T
110 agccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||  |||||||| |||||||| ||||||||||||| ||||||||||||    
41220695 agccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaagcc 41220744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 41032057 - 41031904
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||||||||||||||||||| ||||||||||| ||||||| ||||| ||||||||||||| ||| ||||||||||  |||||||||| ||||||||||||    
41032057 ttgggctccagtggcaaggagctccttccaaggacgtaccagggaacaccgggttcgattcccagggggaacaacacttggccagtgtgcatgcctctac 41031958  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||| ||||| |||||||| | |||||||||||||||||||||  ||||||||||    
41031957 gcacgagccggattagtcacccacctttggtgggtcggaaaccagtgcgaaagc 41031904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 8410085 - 8410240
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| || ||||| ||||||||||| ||| ||||||||||  ||||||||||||||||||||||    
8410085 ttgggctccagtggcaaggagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 8410184  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||| ||| ||||| ||||||||||| ||||||||||||    
8410185 cgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaaagcc 8410240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 10026768 - 10026614
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||| |||||| |||  ||||||||||||||||  || ||||||||||| ||||||||||||||||||||||    
10026768 ttgggctccaatggcaaggagctccttccaaggacgtactcggaaaataccgggttcgattctcagggggaacaacgtttggccagtgcgcatgcctcta 10026669  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| |||||||||  |||||||||||||||||||||| ||| ||||||    
10026668 cgcatgagccggattagtcgaccacctttggtgggtcggaaactagtgtgaaagc 10026614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 12864174 - 12864331
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| ||||||||||  |||||  ||||||||||||| ||||||||||| ||||||||||  |||| |||||||||||||    
12864174 ttgtttgggctccagtgacaaggagctccttccaatgacgtattcggggaataccggattcgatttccagggggaacaacacttggtcagtgcgcatgcc 12864273  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||| ||||||||||||||||||||  |||| |||||||||||||||| ||||||||||    
12864274 tctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 12864331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 38962713 - 38962870
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||| ||||| ||| || |||| ||||| ||||||||||||||||||||||| || | ||||||||| ||||||||||||||||||    
38962713 ttgtttggactccagtggtaaggagctcatttcaaggacgtatccggggaataccgggttcgattttcaggaggaacaacgcttggccagtgcgcatgcc 38962812  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||| || |||||||||  ||||||||||||||| ||||||||||||||||    
38962813 tctacgcatgaaccggattagtcgtccacctttggtgggtcagaaactggtgcgaaag 38962870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 2528497 - 2528338
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||||||||||| |||||| || |||| ||||||||||||| ||| ||||||||||| |||| ||||| |||||||    
2528497 ttgtttgggctccagtggcaatgagctccttccaaggacgtactcgaggaacaccgggttcgattcccagggggaacaacgcttggtcagtgtgcatgcc 2528398  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| ||| |||| ||||||||||||| |||| ||| ||||||||||||||||||||||    
2528397 tctacacataagccggattagtcgctcatctttagtgagtcggaaactggtgcgaaagcc 2528338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 9 - 159
Target Start/End: Original strand, 22593093 - 22593242
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||||||||||||||| ||||||||||| ||||||| ||||||||| | |||||||| ||| ||||||||||| ||||||||||||||||||||||||||    
22593093 gctccagtggcaaggagctccttccaaggacgtacccggggaatactgagttcgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgca 22593191  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| |||||||||  ||||||||||||||||| ||| ||||||||||||    
22593192 tgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaagcc 22593242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 331455 - 331597
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||| || ||| ||||||| ||||||| |||||||||||||||||||| ||| ||||||||||  ||||||||||||||||| ||||    
331455 ttgggctccagtggcaatgagctctttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcttcta 331554  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||| |||||||||| |||||||||||||| ||||||    
331555 cgcatgagccggattagtcgcccacctttggtgggttggaaac 331597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 10 - 158
Target Start/End: Complemental strand, 25540551 - 25540402
Alignment:
10 ctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    ||||||||||||||| ||| ||||||| ||||| | ||||||||| |||||||||| | | ||||||||||| ||||||||||||||||||||||||||     
25540551 ctccagtggcaaggagctcattccaaggacgtatctggggaatactgggttcgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcac 25540452  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| |||||||||  ||||||||||||||||||||| |||||||||||    
25540451 gagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 25540402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 5 - 156
Target Start/End: Complemental strand, 10046628 - 10046477
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||||||||| |||| |||||||||||||||||  |||||| ||||||| ||| | ||||||||||||||||    
10046628 ttgggctccaatggcaaggagctccttccaagaacgtatccggagaataccgggttcgattctcaagggaaacaacgtttgac-agtgcgcatgcctcta 10046530  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||| |||||||||  |||||||||||||||||||||| ||| ||||    
10046529 cgcatgagccggattagtcgaccacctttggtgggtcggaaactagtgtgaaa 10046477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 20 - 159
Target Start/End: Original strand, 10823029 - 10823169
Alignment:
20 aaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatt 118  Q
    ||||| ||||||||||| ||||||| ||||||||||||||| |||| ||| | ||||||||| |||||||||||||||||||||||||| ||||| ||||    
10823029 aaggagctccttccaaggacgtacccggggaataccgggtttgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggatt 10823128  T
119 agtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| ||||||| ||||||||||||| ||||||||||||    
10823129 agtcgcccaccttttgtgggtcggaaaccggtgcgaaagcc 10823169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 43 - 159
Target Start/End: Original strand, 12455303 - 12455419
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||||||||||||||||||| ||| ||||||| || ||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||    
12455303 ccggggaataccgggttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcgg 12455402  T
143 aaactggtgcgaaagcc 159  Q
    |||| ||||||||||||    
12455403 aaaccggtgcgaaagcc 12455419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 3644039 - 3643885
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||| ||||| ||| ||||||| ||||| ||||||||||||||||| |||||| | | ||||||||| ||||||||||||||||||||||    
3644039 ttgggctccagtggaaaggagctcattccaaggacgtatccggggaataccgggtttgatttctacgaggaacaacgcttggccagtgcgcatgcctcta 3643940  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||  |||||||||  ||||||||||||| ||||||| | |||||||||    
3643939 cgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaaagc 3643885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 44139438 - 44139592
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||  |||||||||||||||| | | | | |||||||||||||||||||| ||| ||||||||||| ||||||||||||| ||||||||    
44139438 ttgggctccagtggtgaggaactccttccaaggatgcatctggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcgtgcctcta 44139537  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||||| |||||||||| ||||  ||||||||||||||| |||||||||||    
44139538 cgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaaagc 44139592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 6358307 - 6358150
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| | ||| ||| ||| ||||| |||||||||||| | ||||||||||| ||||||||||  ||||||||||||||||||    
6358307 ttgtttgggctccagtggcaagaagctcattcaaaggacgtatccggggaataccagattcgatttccagggggaacaacacttggccagtgcgcatgcc 6358208  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| |||||||||  |||| ||||||||||| |||| |||| |||||    
6358207 tctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccggtgtgaaag 6358150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 45263823 - 45263682
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||||| ||| ||  || |||||||||||||||||||||| |||  |||||||||| ||||||||||||||||||    
45263823 ttgtttgggctccagtggcaaggagctcctttcaaaaatttatccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgcc 45263724  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcg 141  Q
    |||||||| ||||| ||||| ||||||| |||||||||||||    
45263723 tctacgcacgagccggattaatcgctcatctttggtgggtcg 45263682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 7787010 - 7787158
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||||||||| | || ||||||| |||||||||||||||||||||||| |||||||||   ||||||||| ||||||||||||    
7787010 ttgggctccagtggcaaggaactcctttctaggacgtacccggggaataccgggttcgatttccagggggaacaatacttggccagtacgcatgcctcta 7787109  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||| ||||| |||||||||| || ||||||||| ||| |||| |||||    
7787110 cgcacgagccggattagtcgcccatctttggtggatcgaaaaccggtgc 7787158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 2550822 - 2550975
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| |||||| |||| ||||| |||||||||| ||||||||||| ||| | ||||||||  || ||||||||||||| |||||    
2550822 ttgggctccagtggcaaggagctccttacaaggacgtatccggggaatatcgggttcgattcccaggaggaacaacacttagccagtgcgcatgtctcta 2550921  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| |||||||||| ||| |||||||||| | |||| ||||||||||    
2550922 cgcatgagccggattagtcgcccacttttggtgggttgaaaaccggtgcgaaag 2550975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 21286394 - 21286551
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||| |||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| | | ||||||| ||| ||||||||||||||    
21286394 ttgtttgagctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaggcgaaacaacgcttgaccagtgcgcatgcc 21286493  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||  |||||||| |||| | ||||||||| |||||| ||||| ||||    
21286494 tctacgcacgagctggattagtcactcatcattggtgggttggaaaccggtgcaaaag 21286551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 19 - 159
Target Start/End: Complemental strand, 34346425 - 34346284
Alignment:
19 caaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagat 117  Q
    |||||| ||| ||||||| ||||||| ||||||||| ||||| ||||  || ||||||||||  |||||||||| ||||||||||||||||||| |||||    
34346425 caaggagctcattccaaggacgtacctggggaatactgggtttgattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagat 34346326  T
118 tagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    || |||||||||||||||||||||||||| ||||||||||||    
34346325 taatcgctcacctttggtgggtcggaaaccggtgcgaaagcc 34346284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 3811847 - 3811688
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| || || ||||||||||||||||||||| |||||| || |||||| ||||||||||| |||  |||||||||  |||| || ||||||||||    
3811847 ttgtttggtcttcaatggcaaggaactccttccaaggacgtactcgaggaatatcgggttcgattcccagagggaacaacacttggtcaatgcgcatgcc 3811748  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| |||| ||||||||||||||| ||||| | ||||||||||    
3811747 tctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaaagcc 3811688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 34356156 - 34356311
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||  ||||||| ||||| | |||||||||||||||||||||||| ||||||||||  |||| |||||||||||||    
34356156 ttgtttgggctccagtggcaaggagctatttccaaggacgtatctggggaataccgggttcgatttccagggggaacaacacttggtcagtgcgcatgcc 34356255  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||| ||||||||| ||||| |||  |||| ||| ||||||||||||  |||||||    
34356256 tctatgcatgagccggattaatcgtgcaccattgatgggtcggaaacgagtgcgaa 34356311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 37560123 - 37560282
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||| ||| | ||||||||||| ||||||| | |||||||| |||||||||  |||||||||||||| |||| |||||||||||||    
37560123 ttgtttgggctccagtggtaagaagctccttccaaggacgtacccgaggaataccaggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcc 37560222  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| ||||| |||  |||||||| ||||||| |||| |||| |||||||    
37560223 tctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtgtgaaagcc 37560282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 5 - 151
Target Start/End: Complemental strand, 39201660 - 39201513
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||  ||||||||||| ||||||||||| |||||| || |||||||||  |||||||  || ||||||||| | |||||||||| |||||||||||    
39201660 ttgggctatagtggcaaggagctccttccaaggacgtactcgaggaataccgaattcgattctcagggggaacaatgtttggccagtgtgcatgcctcta 39201561  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtg 151  Q
    |||||||||| ||||||||| |||||||||||||||||||||| ||||    
39201560 cgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 33005706 - 33005858
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||| || | || ||||||| | ||||||||||||||  || ||| ||||||||||  ||||||||||||||||||||||    
33005706 ttgggctccagtggcaaggagctcatttctaggacgtacccgtggaataccgggttctgttccca-ggggaacaacacttggccagtgcgcatgcctcta 33005804  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||||| |||||||||||| ||||||||||||| | ||||||||    
33005805 cgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 28616536 - 28616377
Alignment:
1 ttgtttgggctccagtggcaa-ggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgc 98  Q
    |||||||| |||||||| ||| ||||||||||||||| || || ||| |||||| |||||||||||| || |||||| |||  |||| ||||||||||||    
28616536 ttgtttggactccagtgacaaaggaactccttccaaggacatatccgcggaatatcgggttcgattttcagggggaataacacttgggcagtgcgcatgc 28616437  T
99 ctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||| |||||||||||||||| || |||| ||||||| ||||| |||||||||||    
28616436 ctctacgcacgagccagattagtcgcccatctttagtgggtcagaaaccggtgcgaaagc 28616377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 44945548 - 44945702
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||||||||||| |||||| ||| |||||| ||||| |||| ||| | ||||||||| ||||  ||||||||||||||||    
44945548 ttgggctcaagtggcaaggagctccttccaaggacgtactcggagaatactgggtttgattccca-gaggaacaacgcttggatagtgcgcatgcctcta 44945646  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||| ||||||| |||| |||||||| ||||||||||||    
44945647 cgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagcc 44945702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 13026558 - 13026408
Alignment:
10 ctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    ||||||||||||||||||||||||||| ||||| || ||||||| |||||||||||  || | ||||||| |||||||||||||||||||||||||||||    
13026558 ctccagtggcaaggaactccttccaaggacgtatccagggaatatcgggttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcat 13026459  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| ||||||||   ||| |||||| |||| ||||| | ||| ||||||    
13026458 gagccggattagtcagccacttttggtaggtcagaaaccgatgcaaaagcc 13026408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 9360900 - 9360747
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| ||| |||||||| ||| ||||||| ||||||| |||||||||| ||||||||| | |  || ||||||| ||||||||||||||||||||||    
9360900 ttgggcttcaggggcaaggatctcattccaaggacgtacccggggaataccaggttcgattactagaggaaacaacgtttggccagtgcgcatgcctcta 9360801  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| |||||  ||||||||| ||||||| ||||| ||||||| ||||||||||    
9360800 cgcacgagccgaattagtcgcccacctttagtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 13 - 157
Target Start/End: Original strand, 16034899 - 16035044
Alignment:
13 cagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||| ||||||||||||||||| ||||| ||| ||||||||||||||||||| || | ||||||||| ||| |||||| |||||||| |||| | |||    
16034899 cagtggtaaggaactccttccaaggacgtatccgaggaataccgggttcgattttcaggcggaacaacgcttgaccagtgtgcatgcctatacgtacgag 16034998  T
112 ccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    || ||||||||||||||| ||| || ||||||||| ||||||||||    
16034999 ccggattagtcgctcaccattgatgagtcggaaaccggtgcgaaag 16035044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 19976963 - 19976806
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| | ||| ||||||| ||||| ||||||||||||||||||||||| || |||||| |||| |||| ||||||||||| |    
19976963 ttgtttgggctccagtggcaagtagctctttccaaggacgtatccggggaataccgggttcgattttcagggggaataacgtttggtcagtgcgcatgtc 19976864  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||| || |  ||||||||| |||||||| ||  |||||||  ||||||||||    
19976863 tctacgcataagtcgaattagtcgcccacctttgatgaatcggaaatcggtgcgaaag 19976806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 35946693 - 35946845
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| | |||| ||||| ||| ||| ||| ||||| ||||||||||||| |||||||| || |||||||||||| ||||||| || |||||||||||    
35946693 ttgggcttccgtggtaaggagctcattctaaggacgtatccggggaataccgagttcgatt-cctaggggaacaacgcttggccattgtgcatgcctcta 35946791  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||| |||||||||  |||| |||||||||||||||||||||||||||    
35946792 cgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag 35946845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 39807041 - 39806884
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||   |||||| |||| ||||||| |||||||||||||||||||| ||||| | ||||||| ||||||||||||||||||    
39807041 ttgtttgggctccagtggcaagatgctccttacaaggacgtacccggggaataccgggttcgattcccaagagaaacaacgtttggccagtgcgcatgcc 39806942  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| || ||| | ||||||||   |||||||||||| ||  |||| ||||||||||    
39806941 tctacacacgagtcggattagtcatccacctttggtggttcataaaccggtgcgaaag 39806884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 15079437 - 15079557
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||||||||||| ||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||| ||| |||||| ||||| |||||    
15079437 ttgggctccggtggcaaggaacaccttccaaggacgtacccggggaatacagggttcgatttccagggggaacaacgcttgaccagtgtgcatgactcta 15079536  T
104 cgcatgagccagattagtcgc 124  Q
    |||| |||||| |||||||||    
15079537 cgcacgagccaaattagtcgc 15079557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 11069828 - 11069986
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| ||||||| |||| |||| ||| ||||||| ||||||| |||||||||| ||||||||| | | ||||||||||| ||||||||||||||| ||    
11069828 ttgttttggctccaatggctaggagctcattccaaggacgtacccggggaataccaggttcgattccgagggggaacaacgtttggccagtgcgcatacc 11069927  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||   ||||||||  |||| |||||||||||||||| | |||||||||    
11069928 tctacgcacgagctgaattagtcgtccaccgttggtgggtcggaaaccgatgcgaaagc 11069986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 5 - 156
Target Start/End: Complemental strand, 20612688 - 20612534
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaag-gggaacaacgattggccagtgcgcatgcctct 102  Q
    |||||||||||||||||||| |||||||||||   |||  |||||||||||||||||||||  || | |||||||||  |||||||||||||||||||||    
20612688 ttgggctccagtggcaaggagctccttccaaggttgtattcggggaataccgggttcgattctcaggagggaacaacacttggccagtgcgcatgcctct 20612589  T
103 acgcatgagcc-agattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    | |||||||||  |||||||||  |||| |||||||||||||||| |||||||||    
20612588 atgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 20612534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 21180470 - 21180344
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| |  ||||||||| ||||||| ||| || |||||||  ||||||||||| ||||||    
21180470 ttgtttgggctccagtggcaaggagctccttccaaggacgtacccgaagaataccggattcgattcccatggagaacaacacttggccagtgcacatgcc 21180371  T
100 tctacgcatgagccagattagtcgctc 126  Q
    |||||||| ||||| ||||||||||||    
21180370 tctacgcacgagccggattagtcgctc 21180344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 29422165 - 29422323
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||| ||||||| |||||| |||| ||||||| ||||||||| ||||||||||||||  |||||||||  ||||||| || |||| ||    
29422165 ttgtttgggctccagtagcaaggagctcctttcaaggacgtacccggggaatactgggttcgatttccagagggaacaacacttggccaatgagcatacc 29422264  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    | |||||| ||||| |||||||||  |||||||| ||| |||||||  |||||||||||    
29422265 tttacgcacgagccggattagtcgtccacctttgatggatcggaaatcggtgcgaaagc 29422323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 42770803 - 42770661
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||| || ||||||||||| ||||| ||| | |||||||||||| |||  || ||||||||||| |||||||||||||||||||||     
42770803 ttgggctccagtggcaaagagctccttccaaggacgtatccgagaaataccgggttcaattctcagggggaacaacgcttggccagtgcgcatgcctctt 42770704  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| ||||| ||||| |||  |||||||||||||||| ||||    
42770703 cgcacgagccggattaatcgtccacctttggtgggtcgaaaac 42770661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 14169765 - 14169608
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| ||||||  || ||||||| |||||  ||||||||| |||||||||||  |  ||||||||||  ||| |||||||||||| |    
14169765 ttgtttgggctccagtgacaaggagatctttccaaggacgtattcggggaatatcgggttcgattctccgggggaacaacacttgaccagtgcgcatgtc 14169666  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| |||||||||   ||| |||||||||||||||| ||||||||||    
14169665 tctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaag 14169608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 57 - 158
Target Start/End: Original strand, 16325602 - 16325703
Alignment:
57 gttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||| ||| ||||||||||  |||||||||| |||||||||||||||||||||||||||||||  |||| |||||||||||||||| |||||||||    
16325602 gttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 16325701  T
157 gc 158  Q
    ||    
16325702 gc 16325703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 10669546 - 10669694
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||| || ||||| ||||||||||| ||||||| ||||  ||||||||| |||| ||| || |||||||| |||||||||||||||| |||||    
10669546 ttggactccaggggtaaggatctccttccaaggacgtacctgggggctaccgggtttgattcccagggagaacaacgcttggccagtgcgcatgtctcta 10669645  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||| ||| | ||||| ||| |||||||||||||||||||||| |||||    
10669646 cgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtgc 10669694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 24179521 - 24179657
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||||||||| |||||||| || ||||||||||| |||||||   ||||||||| |||||||  || ||||||||||| ||||||||||| |||||||    
24179521 ttgtttgggctctagtggcaaagagctccttccaaggacgtacccatgaataccgg-ttcgattctca-ggggaacaacgtttggccagtgcacatgcct 24179618  T
101 ctacgcatgagccagattagtcgctcacctttggtgggt 139  Q
    ||||||||||||| |||||||||  || |||||||||||    
24179619 ctacgcatgagccggattagtcgtccatctttggtgggt 24179657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 2 - 157
Target Start/End: Original strand, 29697475 - 29697630
Alignment:
2 tgtttgggctccagtggcaaggaactccttccaagaacgtaccggg--gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||||||||||||| |||||||  ||  |||||| | ||| || |||| |||||||||||| || || | |||||||| |    
29697475 tgtttgggctccagtggcaaggaactccttccaataacgtacacggaagaatactgagtttga-ttcccaggggaacaacg-tttgctaatgcgcatgtc 29697572  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||  |||||||||||||||||||| ||||||||||  || ||||||||    
29697573 tctacgcatgagttagattagtcgctcacctttgctgggtcggaatttgttgcgaaag 29697630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 29653584 - 29653714
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    |||||||||||||| ||||| |||||||| |||||| | || |||||||| ||||||||||| ||  ||||||| |||| ||||||||||||||||||||    
29653584 ggctccagtggcaatgaacttcttccaaggacgtactccggaaataccggattcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgc 29653683  T
107 atgagccagattagtcgctcacctttggtggg 138  Q
    | |||||  ||||||||| |||||||||||||    
29653684 acgagccgaattagtcgc-cacctttggtggg 29653714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 20963265 - 20963120
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||  ||||| ||||||||||| | |||||||||||||  | ||||||  ||| ||| ||  ||||||    
20963265 ttgtttgggctccagtggcaaggacctccttccaatgacgtatccggggaatac-gagttcgatttccaaaagaaacaacacttgaccaatgtacatgcc 20963167  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| ||||| |||||||||||| |||||||| ||||||| ||||    
20963166 tctacgtatgaggcagattagtcgcccacctttgatgggtcgaaaac 20963120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 37805043 - 37804901
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| |||||||||||||||||| ||||| ||||||| | ||| |||||| |||||||  || |||||| |||| ||||| |||||||||||| |||    
37805043 ttgggctacagtggcaaggaactcctcccaaggacgtacccgagaaataccggattcgattcacagggggaataacgcttggctagtgcgcatgccgcta 37804944  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||| |||||| || || |||| ||| ||||||||||||    
37804943 cgcatgagtcagatttgttgcccaccattgatgggtcggaaac 37804901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 18649182 - 18649025
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| | || |||||||| | | |  | ||||||||||| |||||||  || | |||||||   |||| |||||||||||||    
18649182 ttgtttgggctccagtggcaagaagctgcttccaaggatgcattcagggaataccggattcgattctcaggaggaacaatatttgggcagtgcgcatgcc 18649083  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||| | |||||||||||||| |||||||||| |||||| | ||||||||    
18649082 tctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaaag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 34722631 - 34722789
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| ||||||||||| |||||||    |||||  ||||||||||  || || |||||||| |||| |||||| |||| |    
34722631 ttgtttgggctccagtgacaaggagctccttccaaggacgtaccaaatgaatat-gggttcgattctcagggagaacaacgcttggtcagtgcacatgtc 34722729  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| |||||||| ||| || ||||| ||||||||||||    
34722730 tctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaagcc 34722789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 14853523 - 14853421
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||||||||||| |||| | ||| |||||||||||| | |||||||| || ||||||||||  |||||||||||| |||||    
14853523 ttgtttgggctccagtggcaaggaactcctttcaaggatgtatccggggaataccagattcgattttcagggggaacaacttttggccagtgcgtatgcc 14853424  T
100 tct 102  Q
    |||    
14853423 tct 14853421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 48 - 157
Target Start/End: Complemental strand, 3849022 - 3848913
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaact 147  Q
    |||||||||||||||||  || ||| ||||||| |||||||| ||||||| ||||||||| ||| | ||||||||| ||||||||| ||||||| ||| |    
3849022 gaataccgggttcgattatcaggggaaacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctttgatgggtcgaaaatt 3848923  T
148 ggtgcgaaag 157  Q
    ||||||||||    
3848922 ggtgcgaaag 3848913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 20 - 159
Target Start/End: Complemental strand, 15234198 - 15234058
Alignment:
20 aaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatt 118  Q
    ||||| ||||||||||| ||||||| |||||||||  |||||||||  || ||||||||||  ||| ||||||||||||||||||||||  ||  |||||    
15234198 aaggagctccttccaaggacgtacccggggaatactaggttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagatt 15234099  T
119 agtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| ||| ||||| | |||||||||| | ||||||||||    
15234098 agtcgttcatctttgataggtcggaaaccgatgcgaaagcc 15234058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 72 - 159
Target Start/End: Complemental strand, 20116696 - 20116609
Alignment:
72 ggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||  |||||| |||||||||||||||||||||||| |||||| ||  |||||||| |||||||||||| ||||||||||||    
20116696 ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagcc 20116609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 74 - 157
Target Start/End: Original strand, 44773287 - 44773370
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| |||||||||| ||||||||||  || |||||| ||||||||||||||||||| |||||||||||| ||||||||||    
44773287 aacaacgtttggccagtgtgcatgcctctgtgcgtgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag 44773370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 58 - 159
Target Start/End: Complemental strand, 28525554 - 28525452
Alignment:
58 ttcgatttccaaggggaa-caacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||||| |||||| ||||  |||||||||||||||||||||||||| ||||| ||||||||   |||||||  ||||||||||||||||| ||||    
28525554 ttcgatttccagggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtgtgaaa 28525455  T
157 gcc 159  Q
    |||    
28525454 gcc 28525452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 33 - 157
Target Start/End: Original strand, 27725922 - 27726047
Alignment:
33 caagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctt 131  Q
    ||||||||||| ||||||||| || ||| ||||  || | ||||||| | ||||||||||||||||||||||||||  |||| |||||||||| ||||      
27725922 caagaacgtactcggggaatatcgagtttgattctcaggaggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaa 27726021  T
132 tggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||| |||| |||||    
27726022 tggtgggtcggaaaccggtgtgaaag 27726047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 2149351 - 2149243
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgg-gttcgatttccaaggggaacaacgattggccagtgcgcatgc 98  Q
    ||||||||||||||||||||||||||| ||| |||| | ||| | |||||||||||| ||||||||  |  |||||| |||| |||||||||||||||||    
2149351 ttgtttgggctccagtggcaaggaacttctttcaaggatgtatctggggaataccggagttcgattcactgggggaataacgtttggccagtgcgcatgc 2149252  T
99 ctctacgca 107  Q
    |||||||||    
2149251 ctctacgca 2149243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 73 - 159
Target Start/End: Complemental strand, 13104908 - 13104822
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||||||||||||||||||||||||||||| | ||||||||   ||||||| | ||||| ||||||||| |||||||    
13104908 gaacaacgcttggccagtgcgcatgcctctacgcatgagctaaattagtcgtctacctttgataggtcgaaaactggtgtgaaagcc 13104822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 4 - 123
Target Start/End: Original strand, 25549681 - 25549801
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||||||||||||||||||| ||||||||||| |||||   ||||||||| ||||||||||   | ||  ||||||  ||||| ||||| |||||||||    
25549681 tttgggctccagtggcaaggagctccttccaagtacgtatttggggaatactgggttcgattcttagggaaaacaacatttggctagtgcacatgcctct 25549780  T
103 acgcatgagccagattagtcg 123  Q
    ||||| ||||| |||||||||    
25549781 acgcacgagccggattagtcg 25549801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 26 - 156
Target Start/End: Original strand, 2784908 - 2785038
Alignment:
26 ctccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    |||||| |||| ||||| ||| ||||||||| ||||||||| || ||| |||||   |||| ||||||||||||||||||||||||| |||||||||||     
2784908 ctcctttcaaggacgtatccgaggaataccgagttcgattttca-gggaaacaagatttggtcagtgcgcatgcctctacgcatgagtcagattagtcgt 2785006  T
125 tcacctttggtgggtcggaaactggtgcgaaa 156  Q
     || | ||| || ||||||||| |||||||||    
2785007 ccatcattgatgagtcggaaaccggtgcgaaa 2785038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 16813320 - 16813176
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| ||||||| || |||||| ||||||||||| |||||| ||| |||||||  |||| | || || ||||||||||| ||| ||||| ||||||||    
16813320 ttgtttaggctccactgacaaggagctccttccaaggacgtactcggagaataccaagttcaactttca-ggggaacaacgtttgaccagtacgcatgcc 16813222  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||| ||| ||||| |||||||||  || ||||||| ||| |||||    
16813221 tctatgcacgagccggattagtcgtccatctttggtaggttggaaa 16813176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 16852599 - 16852455
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| ||||||| || |||||| ||||||||||| |||||| ||| |||||||  |||| | || || ||||||||||| ||| ||||| ||||||||    
16852599 ttgtttaggctccactgacaaggagctccttccaaggacgtactcggagaataccaagttcaactttca-ggggaacaacgtttgaccagtacgcatgcc 16852501  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||| ||| ||||| |||||||||  || ||||||| ||| |||||    
16852500 tctatgcacgagccggattagtcgtccatctttggtaggttggaaa 16852455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 23500837 - 23500760
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaa 78  Q
    ||||||||||||| |||||||||| ||||||||||  ||||| ||||||||| ||||||||||| ||| | |||||||    
23500837 ttgtttgggctccggtggcaaggagctccttccaaagacgtatcggggaatatcgggttcgattcccaggaggaacaa 23500760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 82 - 159
Target Start/End: Original strand, 26805328 - 26805405
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| |||||||||||||||||| | |||||||||| |||||||||||| ||| |||| | ||| ||||||    
26805328 ttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccgatgcaaaagcc 26805405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 5 - 108
Target Start/End: Complemental strand, 40969067 - 40968963
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| |||||||| ||  || ||||||| |||| | | ||||||||||||||||||||||| ||  ||||||| |||| ||||||| |||||||||    
40969067 ttgggctctagtggcaatgagttcattccaaggacgttctcagggaataccgggttcgatttccagggaaaacaacgtttggtcagtgcgaatgcctcta 40968968  T
104 cgcat 108  Q
    |||||    
40968967 cgcat 40968963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 81 - 156
Target Start/End: Original strand, 21641981 - 21642056
Alignment:
81 attggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||| | ||||||||||||||||||||||||  |||| |||| | |||||||||||||| |||| |||||||||    
21641981 attggctaatgcgcatgcctctacgcatgagccgaattaatcgcccgcctttggtgggtcgaaaaccggtgcgaaa 21642056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 34130456 - 34130299
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||||||||||||||  | ||||||||| ||||   ||||| || | |||||||||| || || |||||||| ||| ||| ||| |||| |    
34130456 ttgtttggcctccagtggcaaggagtttcttccaaga-cgtattagggaaatatcaggttcgattttca-ggagaacaacgtttgaccattgcacatgtc 34130359  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||||||   ||| ||||| | |||||||  ||||||||||||    
34130358 tctacgcatgagccagattagtcgtctaccattggtagatcggaaatcggtgcgaaagcc 34130299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 41187799 - 41187926
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||| |||||| | |||||||||| ||||||||||| ||||| ||| |||||||||  ||| |||   | |   ||||||| ||| ||||||||||||||    
41187799 ttgtctgggcttcggtggcaaggagctccttccaaggacgtatccgaggaataccgaattcaattcttaggaaaaacaacgcttgaccagtgcgcatgcc 41187898  T
100 tctacgcatgagccagattagtcgctca 127  Q
    |||||||||||| | |||||||||||||    
41187899 tctacgcatgagacggattagtcgctca 41187926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 106 - 159
Target Start/End: Complemental strand, 44548774 - 44548721
Alignment:
106 catgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||  |||||||| ||| |||||||||||||||||||||    
44548774 catgagccagattagtcgtccacctttgatggatcggaaactggtgcgaaagcc 44548721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 74 - 157
Target Start/End: Complemental strand, 18846303 - 18846220
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| |||| |||||||||||||| |||| | ||||||||||| ||||||| | ||| ||| ||| |||| ||||||||||    
18846303 aacaacgcttgggcagtgcgcatgcctttacgtacgagccagattaatcgctcatcattgatggatcgaaaaccggtgcgaaag 18846220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 29802765 - 29802916
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||| |||| ||||||| || ||| ||||||  ||||| | | ||||| ||| ||| ||| ||| | | ||||||| ||||||||||| |||||||||||    
29802765 ttggactccggtggcaatgagctctttccaaagacgtatccgagaatatcggattcaattcccatgagaaacaacgtttggccagtgcacatgcctctac 29802864  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
     || || | |||||||||||||||  ||  |||||| ||||| |||||||||    
29802865 acacgaactagattagtcgctcactatttatgggtcagaaaccggtgcgaaa 29802916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 82 - 157
Target Start/End: Original strand, 34420235 - 34420310
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||| ||||||| ||| ||||||| |||||||||| ||||  ||||||||||||||||| ||| ||||||    
34420235 ttggtcagtgtgcatgcccctatgcatgagtcagattagtcactcaattttggtgggtcggaaaccggtacgaaag 34420310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 49 - 112
Target Start/End: Complemental strand, 43303399 - 43303336
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    |||| |||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||| ||||    
43303399 aatatcgggttcgattttcaaggggaacaacgcttgaccagtacgcatgcctctatgcacgagc 43303336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 105 - 159
Target Start/End: Original strand, 13514048 - 13514102
Alignment:
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||| |  ||||||||||||||| |||||||||| ||||||    
13514048 gcatgagccagattagtcaccaacctttggtgggtcgaaaactggtgcaaaagcc 13514102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 111
Target Start/End: Original strand, 25604594 - 25604655
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||||| ||||||||||| ||||||||||| ||| |||||  |||||||||||||||||||    
25604594 aataccggattcgatttcca-ggggaacaacgtttgaccagtatgcatgcctctacgcatgag 25604655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 26805264 - 26805306
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac 43  Q
    ||||||||||||||| |||||||||||||||||||| ||||||    
26805264 ttgtttgggctccagcggcaaggaactccttccaaggacgtac 26805306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 11 - 112
Target Start/End: Complemental strand, 31596578 - 31596476
Alignment:
11 tccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatg 109  Q
    |||||||||||||| ||||||||||  ||||| |||  ||||| | ||||| |||| || ||||||||| | ||||||||||| ||| | ||||||||||    
31596578 tccagtggcaaggagctccttccaaagacgtatccgtagaatatcaggttctattttcagggggaacaatgtttggccagtgcacatacttctacgcatg 31596479  T
110 agc 112  Q
    |||    
31596478 agc 31596476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 792208 - 792261
Alignment:
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| |||||||||| || |||||||||||||||||| ||||| ||||    
792208 cgcatgagccggattagtcgcccatctttggtgggtcggaaaccggtgcaaaag 792261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 51 - 111
Target Start/End: Original strand, 29421285 - 29421343
Alignment:
51 taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    ||||||||| ||||||  |||||||||||| |||| ||||| |||||||||||||||||||    
29421285 taccgggtttgatttc--aggggaacaacgcttgggcagtgagcatgcctctacgcatgag 29421343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 48 - 133
Target Start/End: Original strand, 41187707 - 41187792
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttg 133  Q
    |||||||||||||||||   | ||||||||||  ||| ||||||  |||||||||||||||||| || ||||||||| ||| ||||    
41187707 gaataccgggttcgattatgagggggaacaacacttgaccagtgtccatgcctctacgcatgagacatattagtcgcccacgtttg 41187792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 75 - 154
Target Start/End: Complemental strand, 31740842 - 31740763
Alignment:
75 acaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    |||||| |||| ||||||| |||| |||| ||| ||| |||| ||||||  |||||||||||| ||| ||||||||||||    
31740842 acaacgcttggtcagtgcgaatgcttctaggcacgagtcagactagtcgtccacctttggtggatcgaaaactggtgcga 31740763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 126 - 159
Target Start/End: Original strand, 29299354 - 29299387
Alignment:
126 cacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||| ||||||||||||    
29299354 cacctttggtgggtcggaaaccggtgcgaaagcc 29299387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 93 - 146
Target Start/End: Original strand, 31088377 - 31088430
Alignment:
93 gcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||||||||||| |||||||| | | |||| ||| ||||||||||||    
31088377 gcatgcctctacgcatgagtcagattagccacccaccattgatgggtcggaaac 31088430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 85 - 156
Target Start/End: Complemental strand, 36480506 - 36480438
Alignment:
85 gccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||||||||||||||||||||||| |   |||||  |||||||| ||||||| |||  |||||||||    
36480506 gccagtgcgcatgcctctacgcatgagccgg---agtcgtccacctttgatgggtcgaaaatcggtgcgaaa 36480438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 46 - 122
Target Start/End: Complemental strand, 33634549 - 33634473
Alignment:
46 gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtc 122  Q
    ||||||||||||||||||| |||  || || |||| || ||||||||||||||| || |||| |||||  |||||||    
33634549 gggaataccgggttcgattcccagaggaaataacgtttagccagtgcgcatgccgctgcgcacgagccgaattagtc 33634473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 108; Significance: 4e-54; HSPs: 51)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 21898606 - 21898761
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||||    
21898606 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctcta 21898705  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||| |||||||| ||||||||||||| ||||||||||||    
21898706 cgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagcc 21898761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 5253375 - 5253221
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||||||    
5253375 ttgggctccaatggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 5253276  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| ||||| |||| ||||||||||||||||||||| |||||||||||    
5253275 cgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaaagc 5253221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 10311621 - 10311467
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||   |||||||||||||| |||||||||||||||| |||||    
10311621 ttgggctccagtagcaaggagctccttccaagaacgtatccggggaataccgggttcgatcctcaaggggaacaacgcttggccagtgcgcatgtctcta 10311522  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||  |||||||||||||||| ||||||||||| ||||||||||||||||    
10311521 cgcacgagttagattagtcgctcaccattggtgggtcgaaaactggtgcgaaagc 10311467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 13036156 - 13036002
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||  ||||||||| |||||||||||| || ||||||||||  ||||||||||||||||||||||    
13036156 ttgggctccagtggcaaggagctccttccaaggacgtattcggggaatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctcta 13036057  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||||||||  |||  |||||||||||||||| |||||||||||    
13036056 cgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcgaaagc 13036002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 29444917 - 29444762
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||||||||||  ||||||| |||| ||||||||||||||||| | ||||||||||| ||||||||||||||||||||||    
29444917 ttgggctctagtggcaaggagctccttccaaagacgtacccgggggataccgggttcgatttctagggggaacaacgcttggccagtgcgcatgcctcta 29444818  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||| |  || ||||||||||||||||||| |||||||||||    
29444817 cgcatgagccggattagttgtccatctttggtgggtcggaaactagtgcgaaagcc 29444762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 8612130 - 8611971
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| | | | ||||||||| ||| |||||| ||||||     
8612130 ttgtttggactccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgct 8612031  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| || |||||||||| ||||||||||||||| ||||| ||||||||||||    
8612030 tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 8611971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 29333294 - 29333138
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||||||| || ||||||||||| |||||||  ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||    
29333294 ttgtttgggctctagtggcaatgagctccttccaaggacgtacccagggaataccgggttcgatttcca-ggggaacaacgtttggccagtgcgcatgcc 29333196  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||  || |||||  |||||||||| |||||| ||| ||||||||||    
29333195 tctacgcatgagccgaatcagtcgtccacctttggtaggtcggtaaccggtgcgaaag 29333138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 12606399 - 12606543
Alignment:
16 tggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    |||||| || ||||||||||||||||| |||||||||||| | ||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||     
12606399 tggcaatgagctccttccaagaacgtatccggggaataccagattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccg 12606498  T
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||||| |  |||||| ||||||||||||    
12606499 gattagtcgcccacctttggtgagctggaaaccggtgcgaaagcc 12606543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 13 - 159
Target Start/End: Complemental strand, 6606241 - 6606094
Alignment:
13 cagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||||||||| ||||||||||| ||||| ||||||||||||||||||||||  || ||||||||||  ||||||||||  ||||||||||||||||||    
6606241 cagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgag 6606142  T
112 ccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    || |||||||||  |||| |||||||||||||||| ||||||||||||    
6606141 ccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 6606094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 13468891 - 13469046
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||  |||||||||| ||||||||||| ||||| |||||||||||| ||||| ||| | | |||||||||||||||| |||||| ||||||||||    
13468891 ttgggctctggtggcaaggagctccttccaaggacgtatccggggaataccaggttcaattcctagggggaacaacgattggtcagtgcacatgcctcta 13468990  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| |||||||||||||||| |||| ||||||||| |||||| ||||||||||||    
13468991 cgcacgagccagattagtcgcccaccattggtgggttggaaaccggtgcgaaagcc 13469046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 14107514 - 14107355
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||  |||||  ||||||||||||||||||||| ||| | ||||||||| ||| ||||||| ||||||    
14107514 ttgtttgggctccagtggcaaggagctccttccaaagacgtattcggggaataccgggttcgattcccaggaggaacaacgcttgaccagtgcacatgcc 14107415  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| |||||||||| ||   || ||||||||||||| ||||||||||||    
14107414 tctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaagcc 14107355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 34954774 - 34954629
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||| |||||||||  || ||||||||||| ||||||||||| ||| ||    
34954774 ttgtttgggctcca-tggcaaggagctccttccaaggacgtacctggggaataccaggttcgattctcagggggaacaacgtttggccagtgcacatacc 34954676  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||||||||||||||||  |||||||| ||||||||||||    
34954675 tctacgcatgagccagattagtcgtccacctttgatgggtcggaaac 34954629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 8932615 - 8932774
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||  |||||||||||||||  |||||||||| | ||| |||||||||| ||||||||||| ||| ||||||||||  ||||| ||||||||||||    
8932615 ttgtttgaactccagtggcaaggagttccttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcc 8932714  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| || | |||||||| |||||||||||| ||||||||||||    
8932715 tctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagcc 8932774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 8944081 - 8944240
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||  |||||||||||||||  |||||||||| | ||| |||||||||| ||||||||||| ||| ||||||||||  ||||| ||||||||||||    
8944081 ttgtttgaactccagtggcaaggagttccttccaaggatgtatccggggaatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcc 8944180  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| || | |||||||| |||||||||||| ||||||||||||    
8944181 tctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagcc 8944240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 12 - 159
Target Start/End: Complemental strand, 30788996 - 30788850
Alignment:
12 ccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatga 110  Q
    ||||||||||||| ||||||||||| | ||| |||||||||| |||||| ||||  ||   ||||||||| |||||||||||||||||||||| ||| ||    
30788996 ccagtggcaaggagctccttccaaggatgtatccggggaatatcgggtttgattctca--tggaacaacgtttggccagtgcgcatgcctctaggcacga 30788899  T
111 gccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||| |||||||||| ||||||||||||||||||||| ||||||||||||    
30788898 gccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 30788850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 3588101 - 3587942
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||||||||||  |  ||||||  ||||| |||| ||||||||||||||||| ||||||||||||||| ||||||||||| ||| ||    
3588101 ttgtttgggctcaagtggcaaggagtttattccaaagacgtatccggagaataccgggttcgattcccaaggggaacaacgcttggccagtgcacatacc 3588002  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| || |||||||||   ||||||| ||| |||||||||| ||||||||||    
3588001 tctacgcatgaaccggattagtcgtcaacctttgatggatcggaaactgatgcgaaagcc 3587942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 19089456 - 19089611
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||| ||||||| ||| || |||| ||||| ||| |||||||| |||| |||| ||| ||||||||||  |||||||||| |||||||||||    
19089456 ttgggctccagtcgcaaggagctcatttcaaggacgtatccgaggaataccaggtttgattcccagggggaacaacacttggccagtgagcatgcctcta 19089555  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||   |||||||||||||||||||| ||||||||||||    
19089556 cgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaagcc 19089611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 3601042 - 3601196
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| |||||||| || ||| ||||||  |||||  ||||||||||||| |||||||  || ||||||||||| ||||||||||||||||||| ||    
3601042 ttgggctctagtggcaaagagctctttccaaatacgtattcggggaataccggtttcgattctcagggggaacaacgcttggccagtgcgcatgcctata 3601141  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    | || ||||| |||||||||  ||||||||||||||||||||| |||||||||||    
3601142 cacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 3601196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 19230713 - 19230576
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||||||||||||||||||||| ||||||||||| ||||||  ||||||||||| |||||||| ||| |||||||||| |||| ||||  ||||||||    
19230713 ttgtttgggctccagtggcaaggagctccttccaaggacgtactcgggaataccggattcgattttcaa-gggaacaacgcttggtcagtatgcatgcct 19230615  T
101 ctacgcatgagccagattagtcgctcacctttggtgggt 139  Q
    ||||||| ||||| ||||||||| ||| | |||||||||    
19230614 ctacgcacgagccggattagtcgttcatcattggtgggt 19230576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 9179892 - 9179747
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||| ||||||| |||||||  ||||||||||||||||||| ||| ||||||||||  ||| |||||  |||| ||    
9179892 ttgtttgggctccagtggcaaggagctcattccaaggacgtacccagggaataccgggttcgattcccagggggaacaacacttgaccagtatgcatacc 9179793  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||||||||  |||||||||  |||||||||||| |||||||    
9179792 tctacgcatgagctggattagtcgtccacctttggtggatcggaaa 9179747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 73 - 159
Target Start/End: Complemental strand, 9633708 - 9633622
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||||||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||| ||||||||||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 9633622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 12635793 - 12635927
Alignment:
26 ctccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    ||||||||||| ||||| |||||||||||| |||| |||| ||| ||| ||||||| ||||| ||||||||||||||||||||  |||| ||||||||||    
12635793 ctccttccaaggacgtatccggggaataccaggtttgattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgc 12635892  T
125 tcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     |||  |||||||||||||||| ||||||||||||    
12635893 ccactattggtgggtcggaaaccggtgcgaaagcc 12635927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 8938665 - 8938822
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| ||||||||||  || || |||||||||||  ||||||||| ||| | ||||||||  ||| |||||||||| ||     
8938665 ttgtttgggctccagtgacaaggagctccttccaaagacatatccggggaatacttggttcgattcccaggaggaacaacacttgaccagtgcgcaagca 8938764  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||  ||||||||  |||||||| |||||||||||| ||||||||||    
8938765 tctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaaag 8938822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 2271453 - 2271313
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||  |||||||||||||||||||||  ||  | |||||||| || ||||||||||||| |||||    
2271453 ttgggctccagtggcaaggagctccttccaaggacgtattcggggaataccgggttcgattctca--gagaacaacgcttagccagtgcgcatgtctcta 2271356  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| ||||| |||||||||  |||||||| |||||| |||||    
2271355 cgcacgagccggattagtcgtccacctttgatgggtcagaaac 2271313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 9147255 - 9147378
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||| ||||| ||| ||||||| ||||||| |||||||| ||||||||||| ||| ||||||| ||  ||| ||||||| ||||||    
9147255 ttgtttgggctccagtgggaaggagctcattccaaggacgtacctggggaatatcgggttcgattcccagggggaacgacacttgaccagtgcacatgcc 9147354  T
100 tctacgcatgagccagattagtcg 123  Q
    ||||||||| |||| |||||||||    
9147355 tctacgcataagccggattagtcg 9147378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 54 - 159
Target Start/End: Original strand, 5029825 - 5029930
Alignment:
54 cgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcg 153  Q
    |||||||||||  || || |||||||| |||| |||||||||||||||||||||||||   |||||||||| || ||||| |||||||||||||||||||    
5029825 cgggttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcg 5029924  T
154 aaagcc 159  Q
    ||||||    
5029925 aaagcc 5029930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 31129201 - 31129289
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| ||||| ||||| |||||||||||||||||||||||||||||||||| |  ||||||||||| ||||||||| |||||||||||    
31129201 ggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc 31129289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 5 - 135
Target Start/End: Complemental strand, 9366575 - 9366445
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||| |||||| ||||||||||| | ||||  |||||||| | ||||||||||  | |||||| |||| ||||||||||||||||||||||    
9366575 ttgggctccagtgacaaggagctccttccaaggatgtacttggggaatatcaggttcgatttttagggggaataacgcttggccagtgcgcatgcctcta 9366476  T
104 cgcatgagccagattagtcgctcacctttggt 135  Q
    |||| ||||| |||||| ||| ||||||||||    
9366475 cgcacgagccggattagacgc-cacctttggt 9366445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 13584597 - 13584443
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct----a 103  Q
    |||| ||||||||| ||||| ||||||| |||||| || |||||||| ||||||||| | |||  |||||||| |||||||||||||||||||||    |    
13584597 gctctagtggcaagaaactc-ttccaaggacgtactcgaggaataccaggttcgattcctaagatgaacaacgtttggccagtgcgcatgcctctatgca 13584499  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||||||| ||||| |||  ||||||||||||||||||||| || |||||||||    
13584498 tgcatgagccggattaatcgtccacctttggtgggtcggaaaccggcgcgaaagcc 13584443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 11142557 - 11142713
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||  ||||| |||| | ||| ||||||| || |||| ||||| ||||| ||||||||  ||  || ||||||| ||| ||||||||||||||    
11142557 ttgtttgggcctcagtgacaagaagctcattccaaggacatacccgggaaataccgagttcgattcgcagtggaaacaacgtttgaccagtgcgcatgcc 11142656  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||||| ||||||||| |  || ||||||||||||||| || |||||||||    
11142657 tctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa 11142713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 21016903 - 21016788
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||||||||| | |||| |||||||  || | ||||| |||||||||||    
21016903 ttgggctccagtggcaaggagctccttccagggacgtacccggggaataccgggttcgattcctaaggagaacaacacttagtcagtgtgcatgcctcta 21016804  T
104 cgcatgagccagatta 119  Q
     |||| | ||||||||    
21016803 tgcataatccagatta 21016788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 81 - 159
Target Start/End: Complemental strand, 14783495 - 14783417
Alignment:
81 attggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| |||| ||||||||||||||||||||| |||||||||  |||| |||||||||||||||| ||||||||||||    
14783495 attggctagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 14783417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 15643980 - 15643844
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||||||||||||||||||| ||| ||||||| ||||| | ||||||| ||||||||| |||  |||||||||||  | ||||| ||||||    |||||    
15643980 ttgggctccagtggcaaggagctcattccaaggacgtatctgggaataacgggttcga-ttcacaggggaacaacactaggccaatgcgca----tctac 15643886  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||| | |||||||||| ||||||| |||||||| ||||    
15643885 gcatgagtcggattagtcgcccacctttagtgggtcgaaaac 15643844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 86 - 158
Target Start/End: Original strand, 30410485 - 30410557
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||||  ||||| ||||||| |||||||||||||||||| | |||||||||    
30410485 ccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaagc 30410557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 34 - 156
Target Start/End: Complemental strand, 8149918 - 8149797
Alignment:
34 aagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttg 133  Q
    ||||||||||| ||||||| ||||||||||| || ||| ||||||   ||| ||| ||| ||||||||||||||| ||||  ||||||||  ||||||||    
8149918 aagaacgtacccgggaatatcgggttcgatt-cctaggagaacaatatttgaccaatgcacatgcctctacgcattagccgaattagtcgtccacctttg 8149820  T
134 gtgggtcggaaactggtgcgaaa 156  Q
    |||||| |||||| |||||||||    
8149819 gtgggttggaaaccggtgcgaaa 8149797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 94 - 159
Target Start/End: Original strand, 14326045 - 14326110
Alignment:
94 catgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||||||||  ||||| ||||||    
14326045 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagcc 14326110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 94 - 159
Target Start/End: Original strand, 14419055 - 14419120
Alignment:
94 catgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||| ||||||||||||| |||||||||||||||||  ||||| ||||||    
14419055 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagcc 14419120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 17115049 - 17114908
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||| | ||||||||||| ||||||  || |||||  |  ||||||| | |   ||||||||| ||||||| ||  ||||||||||    
17115049 ttgggctccagtggcaagaagctccttccaaggacgtacatggagaatattgaattcgattcctagaaggaacaacgcttggccaatggacatgcctcta 17114950  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||||| |||||||||| |||||||| | |||||||||    
17114949 cgcatgagccggattagtcgcccacctttgataggtcggaaa 17114908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 5 - 121
Target Start/End: Complemental strand, 24672018 - 24671901
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| |||||| |||| ||||| | || ||||||||||||| ||| |||  |||||||||  ||| |||||| |||||||||||    
24672018 ttgggctccagtggcaaggagctcctttcaaggacgtatctggagaataccgggttctattcccagagggaacaacacttgaccagtgtgcatgcctcta 24671919  T
104 cgcatgagccagattagt 121  Q
    ||||  |||| |||||||    
24671918 cgcacaagccggattagt 24671901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 8888836 - 8888982
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| ||||||||||  |  ||  ||| ||||| || ||||||| ||  ||||||||  ||||| ||||||| ||||||||||||||| ||    
8888836 ttgtttgggctcctgtggcaaggagttttttttaaggacgtatccagggaatatcgaattcgatttttaagggaaacaacgtttggccagtgcgcatacc 8888935  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||||| | |||||||||  |||||||| ||| ||| ||||    
8888936 tctacgcatgagtcggattagtcgtccacctttgatggatcgaaaac 8888982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 48 - 157
Target Start/End: Original strand, 13391289 - 13391397
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaact 147  Q
    ||||| ||| |||||||| || ||||||||| | |||||||||||||||||||||||||| ||||| |||||||||| ||  |||  ||||||| ||||     
13391289 gaatatcggattcgattttca-ggggaacaatgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccatatttaatgggtcgaaaacc 13391387  T
148 ggtgcgaaag 157  Q
    ||||| ||||    
13391388 ggtgcaaaag 13391397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 49 - 157
Target Start/End: Complemental strand, 33859426 - 33859318
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactg 148  Q
    |||||||||||||||||  | ||||||||||| ||| ||||||||||||||||||||||| || | |||||| | || |  |||||||| ||| |||| |    
33859426 aataccgggttcgatttttagggggaacaacgtttgcccagtgcgcatgcctctacgcattagtcggattagccactaaaatttggtggatcgaaaaccg 33859327  T
149 gtgcgaaag 157  Q
     ||||||||    
33859326 ttgcgaaag 33859318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 71 - 156
Target Start/End: Complemental strand, 32157252 - 32157167
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||  ||| ||||||||||| |||||||||||||||||||||||||   || ||||||||| || ||||| |||| ||||    
32157252 gggaacaacacttgaccagtgcgcatacctctacgcatgagccagattagtcatccatctttggtggatcagaaaccggtgtgaaa 32157167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 3030774 - 3030694
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacg 80  Q
    |||||||||||||||||||||||| ||| ||||||| |||||    ||||||| ||||||||||| ||| |||||||||||    
3030774 ttgtttgggctccagtggcaaggagctcattccaaggacgtatttcgggaatatcgggttcgattcccagggggaacaacg 3030694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 64
Target Start/End: Original strand, 5759586 - 5759646
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    |||||||||||||||||||||||||||||||| ||||| ||| |||||| |||||| ||||    
5759586 ttgggctccagtggcaaggaactccttccaaggacgtacccgaggaatatcgggtttgatt 5759646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 72 - 138
Target Start/End: Original strand, 5333030 - 5333096
Alignment:
72 ggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtggg 138  Q
    ||||||||  ||| |||||||||||| |||||| |||||||||||||||||| ||| |||| |||||    
5333030 ggaacaacacttgtccagtgcgcatgtctctacacatgagccagattagtcgttcatctttagtggg 5333096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 21945247 - 21945356
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||| ||||||| | |||||||||||||||||  ||| ||||| |   ||  ||||| ||||||||||||| ||||||||| || |||||||||    
21945247 ttggactccaatggcaagcagctccttccaagaacgtattcggagaatatcatattttatttctaaggggaacaacgcttggccagttcgtatgcctcta 21945346  T
104 cgcatgagcc 113  Q
     |||||||||    
21945347 tgcatgagcc 21945356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 32048405 - 32048506
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||| ||||| ||||||||||| | |||| || |||||| | | |||||||| || || |||||||| |||| ||||| |||||||    
32048405 ttgtttggactccagtggtaaggagctccttccaaggatgtactcgaggaatatcagattcgattttcagggagaacaacgtttggtcagtgtgcatgcc 32048504  T
100 tc 101  Q
    ||    
32048505 tc 32048506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 141
Target Start/End: Complemental strand, 7300264 - 7300200
Alignment:
77 aacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcg 141  Q
    |||| |||||||||| |||||||||| |||| ||||| ||| ||||||||||| ||| |||||||    
7300264 aacgcttggccagtgtgcatgcctctgcgcacgagccggatgagtcgctcaccattgatgggtcg 7300200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 3 - 104
Target Start/End: Original strand, 10312699 - 10312801
Alignment:
3 gtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctc 101  Q
    |||||||||| ||||| || || ||||||||||| ||  ||| ||||| |||||||||||||| ||| || ||| |||| |||| || || |||||||||    
10312699 gtttgggctctagtggtaaagagctccttccaaggacaaacctgggaaataccgggttcgattcccagggagaataacgtttgggcaatgtgcatgcctc 10312798  T
102 tac 104  Q
    |||    
10312799 tac 10312801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 69 - 122
Target Start/End: Original strand, 10396496 - 10396549
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtc 122  Q
    |||||||||||| |||||||||||||||  ||||| ||||||| | ||||||||    
10396496 aggggaacaacgtttggccagtgcgcatatctctatgcatgagtcggattagtc 10396549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 108; Significance: 4e-54; HSPs: 93)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 5732072 - 5731917
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||||    
5732072 ttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcctcta 5731973  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    || ||||||||||||||||| |||||||| ||||||||||||| ||||||||||||    
5731972 cgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaagcc 5731917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 41163615 - 41163457
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||| ||||||||||| |||| |    
41163615 ttgtttgggctccagtggcaaggagctccttccaagaacgtacccggggaataccgggttcgattccca-ggggaacaacgtttggccagtgcacatgtc 41163517  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||  |||||||||  ||||||| ||||||||||||||||||||||||||    
41163516 tctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaaagcc 41163457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 42086282 - 42086437
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||||||||| ||||||||||| ||||||| | |||||||||||||||||| ||| ||||||||||| ||| ||||||||||||||||||    
42086282 ttgggctccggtggcaaggagctccttccaaggacgtacccgaggaataccgggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctcta 42086381  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||||||||  ||||||||||||||||||||| ||||||||||||    
42086382 cgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagcc 42086437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 1538382 - 1538541
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||||||| || |||||  ||||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||    
1538382 ttgtttgggctccagtggcaaggagctccttccgaggacgtattcggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcc 1538481  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| |||  |||| |||||||||||||||| ||||||||||||    
1538482 tctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaagcc 1538541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 19572679 - 19572834
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |||| ||| ||||||||||  ||||||||||||||||||||||    
19572679 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttagattcccagggggaacaacacttggccagtgcgcatgcctcta 19572778  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||| ||||| ||||||||| ||||||  |||||||||||    
19572779 cgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcgaaagcc 19572834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 9812823 - 9812982
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| | | | ||||||||| |||||||||| ||||||     
9812823 ttgtttggactccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgct 9812922  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| || |||||||||| ||||||||||||||| ||||| ||||||||||||    
9812923 tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 9812982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 4 - 157
Target Start/End: Complemental strand, 25417336 - 25417182
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||    
25417336 tttgggctccagtggcaaggagctccttccaaggacgtactcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctct 25417237  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||| | ||||| ||||||||  | ||| |||||||||| ||||| ||||||||||    
25417236 acgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcgaaag 25417182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 12704965 - 12705124
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| | | | ||||||||| ||| |||||| ||||||     
12704965 ttgtttggactccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattccgaggaggaacaacgcttgaccagtgtgcatgct 12705064  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| || |||||||||| ||||||||||||||| ||||| ||||||||||||    
12705065 tctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 12705124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 12766082 - 12766241
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||   | | ||||||| | |||||||||| |||||||    
12766082 ttgtttggactcgagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattctgaggaggaacaatgcttggccagtgtgcatgcc 12766181  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| ||||||||||||| ||||||||||||||| ||||| ||||||||||||    
12766182 tctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 12766241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 30349530 - 30349689
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||||  |||||||||| ||||| ||||||||||||||||| |||||| | ||||||||| ||||||||||||||||||||    
30349530 ttgtttgggctccagtggcaaggagttccttccaaggacgtatccggggaataccgggtttgatttctagggggaacaatgattggccagtgcgcatgcc 30349629  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||||||   ||||||||  |||||| |||||| ||||||| ||||||||||||    
30349630 tctatgcatgagctgaattagtcgtccaccttaggtgggccggaaaccggtgcgaaagcc 30349689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 8513474 - 8513628
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| ||||||||||| ||||||||||| ||||||| |||||||||||||||||||| | | ||| ||||| | ||||||||||| ||||||||||    
8513474 ttggactcaagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcctaggggaaacaatgcttggccagtgcacatgcctcta 8513573  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||||||||||||  ||||||||||||||||||||| |||||||||||    
8513574 cgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 8513628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 23383599 - 23383766
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg----------ggaataccgggttcgatttccaaggggaacaacgattggccagt 90  Q
    |||||||||||||||||||||||| ||||||||||| ||||| | |          |||||||||||||||||| ||| ||||||||||| |||||||||    
23383599 ttgtttgggctccagtggcaaggagctccttccaaggacgtatcagacgtatcagaggaataccgggttcgattcccagggggaacaacgcttggccagt 23383698  T
91 gcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||||    
23383699 gcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 23383766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 48 - 159
Target Start/End: Original strand, 9805003 - 9805114
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaact 147  Q
    ||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||  |||||||||||||||||||||     
9805003 gaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaca 9805102  T
148 ggtgcgaaagcc 159  Q
    ||||||||||||    
9805103 ggtgcgaaagcc 9805114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 42861374 - 42861215
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||| ||||||| || || |||||||||| ||||||| |||||| |||| ||||||  ||||||||||||||||||    
42861374 ttgtttgggctccagtggcaaggagctcattccaaggacatatccggggaatatcgggttcaatttcccagggaaacaacacttggccagtgcgcatgcc 42861275  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| |||  |||| ||||||||||||| || ||||||||||||    
42861274 tctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaagcc 42861215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 15 - 159
Target Start/End: Original strand, 13664225 - 13664370
Alignment:
15 gtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcc 113  Q
    |||||||||| ||||||||||| ||||| |  ||||||||||| |||||||  || ||||||||||  ||||||||||||||||||||||||||||||||    
13664225 gtggcaaggagctccttccaaggacgtatctagggaataccggattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatgagcc 13664324  T
114 agattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| ||| |||||||||||| ||||||||| ||||||||||||    
13664325 agattaatcgatcacctttggtgtgtcggaaaccggtgcgaaagcc 13664370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 20525793 - 20525945
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| |||||| |||| | ||| |||||||||| ||||||||||| ||| | ||||||||  || |||||||||||||||||||    
20525793 ttgggctccagtggcaaggagctcctttcaaggatgtatccggggaatatcgggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctcta 20525892  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||| |||||||||  |||| ||||||| |||||||| |||||||||    
20525893 cgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaaa 20525945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 7866536 - 7866690
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||| ||||||||||| ||||||| | |||||||||||||||||| | | | ||||||||| |||||||||| |||||||||||    
7866536 ttggactccagtggcaaggagctccttccaaggacgtacccgaggaataccgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctcta 7866635  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| || || |||||||||| ||||||||||||||  |||||  ||||||||||    
7866636 cgcacgaaccggattagtcgcccacctttggtgggttagaaaccagtgcgaaagc 7866690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 45 - 159
Target Start/End: Complemental strand, 38897829 - 38897716
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||| ||||||| || |||||||||||| ||||||    
38897829 ggggaataccgggttcgatttcca-ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaa 38897731  T
145 actggtgcgaaagcc 159  Q
    ||  |||||||||||    
38897730 accagtgcgaaagcc 38897716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 113
Target Start/End: Original strand, 28857083 - 28857192
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||| ||| |||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||||||    
28857083 ttgggctccagtggcaaggagctccttccaaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 28857182  T
104 cgcatgagcc 113  Q
    ||||||||||    
28857183 cgcatgagcc 28857192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 4016411 - 4016252
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||| ||||||||||||||||| | ||| ||||||| ||||||| | ||| || |||||||||||  || ||||||||||  ||||||||||||||||||    
4016411 ttgtatgggctccagtggcaagaagctcattccaaggacgtacctgagaaatatcgggttcgattatcagggggaacaacacttggccagtgcgcatgcc 4016312  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| || ||||| ||||||| ||||||| ||||||||||||||||  |||||||||||    
4016311 tctacacacgagccggattagttgctcaccattggtgggtcggaaaccagtgcgaaagcc 4016252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 20682770 - 20682615
Alignment:
5 ttgggctccagtggcaaggaactcc-ttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||||||||||| |||||| |||| ||| ||| ||||||| ||||||||  ||||| |||||||| ||||||||||| |||||||||||||||||||||    
20682770 ttgggctccagtgacaaggagctccattctaaggacgtacccggggaatattgggttagatttccagggggaacaacgcttggccagtgcgcatgcctct 20682671  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| ||||| ||||| |||  ||||||| |||||| |||||| |||||||||||    
20682670 acgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaagc 20682615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 18136436 - 18136273
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||  ||||| |||| ||||||||||||||||| ||| ||||||||||  |||| ||||| |||||||    
18136436 ttgtttgggctccagtggcaaggagctccttccaaagacgtatccggagaataccgggttcgattcccagggggaacaacacttggtcagtgtgcatgcc 18136337  T
100 tctacgcatgagccag----attagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||| |    ||||||||  |||| |||||||||||||||| ||||| ||||||    
18136336 tctacacatgagccggattaattagtcgtccaccattggtgggtcggaaaccggtgcaaaagcc 18136273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 40117410 - 40117524
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    ||||||||| ||  ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||| ||| |    
40117410 cggggaatatcgaattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaa 40117509  T
144 aactggtgcgaaagc 158  Q
    ||| |||||||||||    
40117510 aaccggtgcgaaagc 40117524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 14 - 157
Target Start/End: Complemental strand, 11845944 - 11845800
Alignment:
14 agtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    ||||||||||| ||||||||||| ||||||| | ||| || ||||||||||||| | ||||||||||| |||||||||||||||||||||||| ||||||    
11845944 agtggcaaggagctccttccaaggacgtacccgagaaatatcgggttcgatttcgagggggaacaacgtttggccagtgcgcatgcctctacgtatgagc 11845845  T
113 cagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |  |||| |||| |||||||| ||||| |||||| |||| |||||    
11845844 cgaattaatcgcccacctttgatgggttggaaaccggtgtgaaag 11845800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 14 - 137
Target Start/End: Original strand, 30995085 - 30995209
Alignment:
14 agtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    ||||||||||| ||||||||||| ||||||  |||||||||| ||||||||| ||| ||||||||||  |||||||| ||||||||||||||||| ||||    
30995085 agtggcaaggagctccttccaaggacgtacatggggaataccaggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagc 30995184  T
113 cagattagtcgctcacctttggtgg 137  Q
    | ||||||||||||| |||||||||    
30995185 cggattagtcgctcatctttggtgg 30995209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 37263196 - 37263347
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||  |||||| ||| ||||||| |||||||| |||||||||||  || ||||||||||| ||||||| ||||||||||||||    
37263196 ttgggctccagtggcaaggagttccttctaaggacgtacccggggaatatcgggttcgattctca-ggggaacaacgcttggccaatgcgcatgcctcta 37263294  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||| ||||| |||||||||  |||||||  ||| |||||||| |||||||||    
37263295 cgcacgagccggattagtcgtccacctttattggatcggaaaccggtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 5079282 - 5079440
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| ||| ||||||| || ||||||||||| ||||| ||| ||||||||||| | |||||||| |||||||| || |||| || |||||||||     
5079282 ttgtttgggttccggtggcaaagagctccttccaagcacgtatccgtggaataccggggttgatttccagggggaacagcgcttggtcaatgcgcatgct 5079381  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| |||||||||| ||||| |||| ||||||||||||    
5079382 tctacgcacgagccggattagtcgcccacctttggt-ggtcgaaaaccggtgcgaaagcc 5079440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 39728338 - 39728497
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||| ||||||||||||||| |||||||||| |||||||||  ||  || ||||||  |||||||||| |||||||    
39728338 ttgtttgggctccagtggcaaggagctctttccaagaacgtacccggggaataccaggttcgattatcagaggaaacaacacttggccagtgtgcatgcc 39728437  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||  ||| |  |||||||||||||||||| |  ||||||||| ||||| ||||||    
39728438 tctacgctcgagtcgaattagtcgctcacctttgatacgtcggaaaccggtgcaaaagcc 39728497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 2485148 - 2485304
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||| ||||||||| ||| ||||||| |||||  | |||||||| |||||||||| || |||||||||||  | |||| |||||||||||    
2485148 ttgtttggactccaatggcaaggagctcattccaaggacgtattcagggaatactgggttcgatt-cctaggggaacaaccctgggcctgtgcgcatgcc 2485246  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||| ||||| | ||||||||||||||||||| |||||||||||| | ||||||||    
2485247 tctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 7308520 - 7308387
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| || ||||||||||| ||| ||||||| |||||   | |||||| ||||||||||| ||| ||||||||||| |||| |||||| ||||||    
7308520 ttgtttgggttctagtggcaaggagctcattccaaggacgtatttgaggaatatcgggttcgattcccagggggaacaacgcttgggcagtgcacatgcc 7308421  T
100 tctacgcatgagccagattagtcgctcacctttg 133  Q
    |||||||||||||| |||||||||||||||||||    
7308420 tctacgcatgagccggattagtcgctcacctttg 7308387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 35561970 - 35561829
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||||||||| || ||||||||||  ||||| |||||||||| || |||||| |||||  |||||||||   || ||||||||||||||||||    
35561970 ttggactccagtggcaaagagctccttccaatgacgtatccggggaatatcgagttcgacttccagagggaacaacacctgaccagtgcgcatgcctcta 35561871  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    | |||||||||||||||||||||||| ||||| |||||||||    
35561870 cacatgagccagattagtcgctcaccgttggtaggtcggaaa 35561829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 14728033 - 14728192
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaagggga-acaacgattggccagtgcgcatgc 98  Q
    ||||||||||||||||||||| || ||| |||||||  | |    ||||| |||||| |||||||| || ||||  |||||| |||| ||||||||||||    
14728033 ttgtttgggctccagtggcaatgagctcattccaaggtcatttttgggaaataccggattcgattttcagggggggacaacgcttggtcagtgcgcatgc 14728132  T
99 ctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||| ||||||| ||||||||||| |||||||||||| |||||||||||    
14728133 ctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc 14728192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 18294639 - 18294494
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| || ||||| |||||||||||||||||| || ||| ||| ||||||||||||| || |||| ||||||||||| |||| |||||||||| ||    
18294639 ttgtttggacttcagtgacaaggaactccttccaaggacatactcggagaataccgggttcaatatcca-ggggaacaacgcttggtcagtgcgcatacc 18294541  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||| ||||| || ||||| |||| || ||||||||||||||||||    
18294540 tctacacatgaaccggattaatcgcccatctttggtgggtcggaaac 18294494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 1898953 - 1899050
Alignment:
2 tgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgc 98  Q
    |||||||||| |||||||||||| ||||||||||| | ||||| |||||||||||||||||||| ||| ||||||||||| |||||||||||||||||    
1898953 tgtttgggctacagtggcaaggagctccttccaaggatgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgc 1899050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 13 - 157
Target Start/End: Complemental strand, 14588761 - 14588616
Alignment:
13 cagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||||||||| || ||| |||| ||||| | |||||||| |||||||||||| || | |||| |||| ||| ||||||||||||||||||||||||||    
14588761 cagtggcaaggagcttctttcaaggacgtatctggggaatatcgggttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatgag 14588662  T
112 ccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    || |||||||||  ||||||||||| | || |||| ||||||||||    
14588661 ccggattagtcgtccacctttggtgagccgaaaaccggtgcgaaag 14588616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 20692884 - 20693041
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||||||| || || |||||||| ||||||| ||||||||||||||| |||| | |  || ||||||| ||||||||| | ||||||    
20692884 ttgtttgggctctagtggcaaagagcttcttccaaggacgtacccggggaataccgggtttgattcctagaggaaacaacgcttggccagtacacatgcc 20692983  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||  ||||||  ||||||||| |  ||||||||||||||||||||| ||||||||||    
20692984 tctgtgcatgattcagattagttgtccacctttggtgggtcggaaaccggtgcgaaag 20693041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 26077092 - 26077225
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||| ||||| ||| ||||||| |||||   |||||||||  ||||||||| |||  |||||||||| ||||||||||| ||||||    
26077092 ttgtttgggctccagtggtaaggagctcattccaaggacgtatttggggaatactaggttcgattcccagagggaacaacgcttggccagtgcacatgcc 26077191  T
100 tctacgcatgagccagattagtcgctcacctttg 133  Q
    |||||||| ||||||||||| ||||||| |||||    
26077192 tctacgcacgagccagattaatcgctcatctttg 26077225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 70 - 159
Target Start/End: Complemental strand, 39099865 - 39099776
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||  ||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||| ||||||    
39099865 ggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagcc 39099776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 3654068 - 3653911
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| ||| || ||| ||||||| ||||||| || ||||||||||||||||| | |  | |||||||| ||| ||||||||||||||    
3654068 ttgtttgggctccagtgacaatgagctctttccaaggacgtacccggagaataccgggttcgattccta--gagaacaacgcttgaccagtgcgcatgcc 3653971  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||| | |||||||||  |||||||||||| ||| |||| ||||| ||||||    
3653970 tctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgcaaaagcc 3653911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 23247507 - 23247349
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| || |||| ||||||| ||| ||||||| ||||||| |||||||| ||||||||||| ||| | ||||||||| |||  ||||  |||||||    
23247507 ttgtttggacttcagtagcaaggagctcattccaaggacgtacctggggaatatcgggttcgattcccaggaggaacaacgcttgatcagtatgcatgcc 23247408  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||||||||||||  |||||||| | ||||| |||| ||||||||||||    
23247407 tctacgcacgagccagattagtcgtccacctttgat-ggtcgaaaaccggtgcgaaagcc 23247349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 35403668 - 35403561
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| |||||| |||| ||||||||||||||||   | ||||||||||| ||||||| |||||||| |    
35403668 ttgtttgggctccagtggcaaggagctccttccaaggacgtactcgggaaataccgggttcgattctaagggggaacaacgcttggccaatgcgcatgtc 35403569  T
100 tctacgca 107  Q
    ||||||||    
35403568 tctacgca 35403561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 41800928 - 41801087
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||| |||| |||||| ||||| |||  ||||| | |||||||| |||||||||||  |||||||||||||| ||| ||| |||||||| |    
41800928 ttgtttggactcccgtggtaaggaattcctttcaatgacgtatctggggaatatcgggttcgattctcaaggggaacaacgcttgaccaatgcgcatgtc 41801027  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| ||||||||| ||| ||||| |||||||||||  |||| |||||||    
41801028 tctacgcacgagccggattagtcgttcatctttgatgggtcggaaagcggtgtgaaagcc 41801087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 9 - 158
Target Start/End: Complemental strand, 9168399 - 9168251
Alignment:
9 gctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||||||||||||||| ||||||||||  ||||| ||||||||||||| |  ||||| ||| | ||||||||| ||||||||||||||| ||||||||||    
9168399 gctccagtggcaagga-ctccttccaaagacgtatccggggaataccgagaacgattccca-gaggaacaacgcttggccagtgcgcatacctctacgca 9168302  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| |||||||||  ||||||| |||||||| |||  ||||| |||||    
9168301 tgagccggattagtcgtccacctttagtgggtcgaaaatcggtgcaaaagc 9168251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 20255320 - 20255478
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||  |||||||||| ||| ||| ||| |||||| |||||||||||||| |||     || |  |||||||  ||| ||||||||||||||    
20255320 ttgtttgggctctggtggcaaggagctcattctaaggacgtactcggggaataccggggtcgtaactcaggacgaacaacacttgaccagtgcgcatgcc 20255419  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| | |||||||||  ||||||||||| |||||||||||||||||||||    
20255420 tctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc 20255478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 56 - 157
Target Start/End: Complemental strand, 24463986 - 24463885
Alignment:
56 ggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||||||||| ||||| ||||||||||||||||||||||||||||||| ||| ||||| |||||||||| |||||||  ||||||| |||| ||||| ||    
24463986 ggttcgattttcaaggcgaacaacgattggccagtgcgcatgcctctatgcacgagccggattagtcgcccacctttactgggtcgaaaaccggtgcaaa 24463887  T
156 ag 157  Q
    ||    
24463886 ag 24463885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 43 - 156
Target Start/End: Complemental strand, 42291618 - 42291505
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||| |||||||||||| |||| ||| || |||||||| ||||||||||| |||||||||||||| ||||| |||||||||  |||||||| ||| ||||    
42291618 ccggagaataccgggtttgattcccagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcgg 42291519  T
143 aaactggtgcgaaa 156  Q
    |||| |||||||||    
42291518 aaaccggtgcgaaa 42291505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 27 - 158
Target Start/End: Original strand, 12081885 - 12082017
Alignment:
27 tccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgct 125  Q
    |||||| ||| ||||| ||||||||||| ||||||||||  || ||||||||||| ||||||||||||||||| |||||||| |||||  ||||||||      
12081885 tccttcaaaggacgtatccggggaatactgggttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtc 12081984  T
126 cacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| ||||||||  |||| ||||||    
12081985 cacctttggtgagtcggaaatcggtgtgaaagc 12082017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 15034037 - 15034172
Alignment:
11 tccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatg 109  Q
    |||||||||||| | ||||||||||| | ||||| |||||||||||||||| ||||||| ||| ||||||  |||| ||||| |||||||||||||||||    
15034037 tccagtggcaag-agctccttccaaggatgtacccggggaataccgggttcaatttccatgggaaacaacacttggtcagtgtgcatgcctctacgcatg 15034135  T
110 agccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| ||||||| |  |||||||| ||| ||||||||    
15034136 agcctgattagttgtccacctttgatggatcggaaac 15034172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 14974465 - 14974343
Alignment:
16 tggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    ||||||||| ||| ||| ||| ||||| |||| ||||| |||||||||||   ||||||||||||  ||||||||||| ||||||||||||||||||||     
14974465 tggcaaggagctcattctaaggacgtatccggagaatatcgggttcgattctaaaggggaacaacatttggccagtgcacatgcctctacgcatgagccg 14974366  T
115 gattagtcgctcacctttggtgg 137  Q
    |||||||||  ||||||||||||    
14974365 gattagtcgtccacctttggtgg 14974343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 43 - 159
Target Start/End: Complemental strand, 18262731 - 18262615
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||||||||||| |||| || ||||||||||| ||| ||||||||||| ||||||| || ||||| |||||||||| ||||| || ||| |||     
18262731 ccggggaataccgggttctattttcagggggaacaacgcttgaccagtgcgcatacctctacacacgagccggattagtcgcccacctctgatggatcga 18262632  T
143 aaactggtgcgaaagcc 159  Q
    |||  ||||||||||||    
18262631 aaatcggtgcgaaagcc 18262615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 14152001 - 14152120
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| ||||||||||||||||| ||||||||||  | ||||| ||||||||||||||||||||  ||  |||||||||| |||||||||| ||||||     
14152001 ttgtttcggctccagtggcaaggagctccttccaatgatgtacctggggaataccgggttcgattctcatagggaacaacgcttggccagtgtgcatgct 14152100  T
100 tctacgcatgagccagatta 119  Q
    ||||  |||||||| |||||    
14152101 tctatccatgagccggatta 14152120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 38297120 - 38297013
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||| ||| | ||||  | |||||||||||||| ||| ||||||||||||||| |||| |||||||||| |     
38297120 ttgtttgggctccagtggcaaggagctccttctaaggatgtacttgaggaataccgggttcaattcccaaggggaacaacgtttggtcagtgcgcattct 38297021  T
100 tctacgca 107  Q
    ||||||||    
38297020 tctacgca 38297013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 28857002 - 28857058
Alignment:
102 tacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
28857002 tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 43399149 - 43399237
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| |||| |||||||||||||||||||||||||| ||||  |||||||||  ||| |||||| |||||||||| |||||||||||    
43399149 ggggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc 43399237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 24498934 - 24499092
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||| ||||||| ||||||||||| ||||| | || ||||| ||||||||||||| |||   || |||| |||  |||||||||||||    
24498934 ttgtttgggctctagtagcaaggagctccttccaaggacgtatctggagaatatcgggttcgatttctaagaa-aataacgcttgatcagtgcgcatgcc 24499032  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| | ||||| ||||| | |  || ||||||||||| ||||| |||||||||||||    
24499033 tctacgtacgagccggattaatagtccatctttggtgggttggaaattggtgcgaaagcc 24499092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 155
Target Start/End: Original strand, 28862784 - 28862931
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||||||||||||||| ||||||||||  |||||  ||||||||| | |||||||||  || | ||||||||| ||||||| ||| ||||||||||||||    
28862784 gctccagtggcaaggagctccttccaaagacgtattcggggaatatcaggttcgattctcaggcggaacaacgcttggccaatgcacatgcctctacgca 28862883  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
     || |   |||||| ||||||| || || |||||||||| ||||||||    
28862884 cgacctgaattagttgctcaccattagtaggtcggaaaccggtgcgaa 28862931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 69 - 158
Target Start/End: Original strand, 7616940 - 7617029
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| ||| |||||  ||||||||||||||||||| |||||||||||  ||   ||||||| ||||||||||||||||||||    
7616940 aggggaacaacgtttgaccagtatgcatgcctctacgcatgagtcagattagtcgtccattattggtggatcggaaactggtgcgaaagc 7617029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 25950738 - 25950641
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    |||||||||||||||||| ||||| ||||||| ||| |||||| ||||||||| | |||| ||||| |||||| ||||||  ||||||||||||||||    
25950738 ttgtttgggctccagtggtaaggagctccttcaaaggacgtactcggggaatatcaggtttgattttcaagggaaacaacacttggccagtgcgcatg 25950641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 6767203 - 6767143
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    |||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||    
6767203 ttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgatt 6767143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 159
Target Start/End: Complemental strand, 17693476 - 17693337
Alignment:
14 agtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    ||||||||||| | ||||||||| |||||| |||||| |||||||||| ||| ||| | ||||||||| ||        |||||||||||||||||||||    
17693476 agtggcaaggagccccttccaaggacgtactcggggagtaccgggttcaattcccaggaggaacaacgctt--------cgcatgcctctacgcatgagc 17693385  T
113 cagattagtcg-ctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| |   | |||||||||| |||||| ||||||||||||    
17693384 cagattagtcgtccgtcttttggtgggttggaaaccggtgcgaaagcc 17693337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 18045597 - 18045746
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||| |||| |||||| || ||||  |||| ||||||||||| |||||||||| ||| ||||||||||  ||||   || ||||||||||||| |    
18045597 ggctccagtagcaatgaactcttttcaagggcgtatccggggaatactgggttcgattcccagggggaacaacccttggttggtacgcatgcctctacac 18045696  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| ||||| |||  ||||||| |||| |||||||| | ||||||||    
18045697 atgagcc-gattaatcgtccacctttagtggatcggaaaccgatgcgaaag 18045746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 47 - 137
Target Start/End: Original strand, 21149732 - 21149822
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgg 137  Q
    |||||||| |||||||||| || ||||||||||| ||| |||||||||||| ||||||||| |||   |||||||||| |||| |||||||    
21149732 ggaataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccattggtgg 21149822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 38369695 - 38369808
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    ||||||||| |||||||||||  || ||||||||||  |||||||||||||||||||||||||| ||| | |||||||  | |||||||| |||||  ||    
38369695 cggggaatatcgggttcgattctca-ggggaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttaga 38369793  T
144 aactggtgcgaaagc 158  Q
    ||  |||||||||||    
38369794 aatcggtgcgaaagc 38369808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 82 - 151
Target Start/End: Complemental strand, 6764531 - 6764462
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtg 151  Q
    ||||| |||||||||||||||||||| ||||| ||||||||||  | ||||| |||||||||||||||||    
6764531 ttggctagtgcgcatgcctctacgcacgagccggattagtcgcctatctttgttgggtcggaaactggtg 6764462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 4 - 159
Target Start/End: Original strand, 18327724 - 18327870
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||| ||||||||||||||| ||||||||||| |||||  | || ||||| ||||||||||||||          || |||||||||| ||||||||||    
18327724 tttggactccagtggcaaggagctccttccaaggacgtattcaggaaatactgggttcgatttcca----------cgcttggccagtgtgcatgcctct 18327813  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     |||||||||||||| ||||||  | |||| ||||||||||||| | ||| ||||||    
18327814 gcgcatgagccagatcagtcgccaatctttagtgggtcggaaaccgatgcaaaagcc 18327870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 28856932 - 28857001
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaagggg 73  Q
    |||||||||||||||||||| ||||||||||| ||| | |||||||||||||||||||||| ||| ||||    
28856932 ttgggctccagtggcaaggagctccttccaaggacgcacccggggaataccgggttcgattcccaggggg 28857001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 35813154 - 35813021
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| | |||||||| | ||| ||||||| ||||||| | |||||||||||||||||| | | ||| || || | ||| |||||||||||| |    
35813154 ttgtttgggctgcggtggcaagaagctcattccaaggacgtacccgaggaataccgggttcgattcctaggggaaataatgcttgaccagtgcgcatgtc 35813055  T
100 tctacgcatgagccagattagtcgctcacctttg 133  Q
    ||||| |||||| | |||||||||  ||||||||    
35813054 tctacacatgagtcggattagtcgtccacctttg 35813021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 47 - 156
Target Start/End: Original strand, 21487615 - 21487721
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| || ||||||||| || | ||||||||| ||||| |||||||||||||||   || ||||| |||||||||| |||||||  ||||||| ||||    
21487615 ggaatatcgagttcgattttcaggaggaacaacgtttggctagtgcgcatgcctct---cacgagccggattagtcgcccacctttaatgggtcgaaaac 21487711  T
147 tggtgcgaaa 156  Q
     |||||||||    
21487712 cggtgcgaaa 21487721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 43 - 158
Target Start/End: Complemental strand, 24653924 - 24653810
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    ||||||||||  ||||||||||| || || |||||||  |||| |||||||||| ||||||||||| |||| ||||| |||  |||| |||||||||||     
24653924 ccggggaatatagggttcgattttcagggagaacaacacttggtcagtgcgcatacctctacgcat-agccggattaatcgtccaccattggtgggtcga 24653826  T
143 aaactggtgcgaaagc 158  Q
    |||| | |||||||||    
24653825 aaaccgatgcgaaagc 24653810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 115 - 158
Target Start/End: Original strand, 28857212 - 28857255
Alignment:
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
28857212 gattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 47 - 137
Target Start/End: Original strand, 7336618 - 7336708
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgg 137  Q
    |||||| ||||||||||||| |||| |||||||| ||   ||||||||||||||||||||| ||||| ||||| |||   |||||||||||    
7336618 ggaatatcgggttcgatttctaaggagaacaacgctttatcagtgcgcatgcctctacgcacgagccggattaatcgtctacctttggtgg 7336708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 159
Target Start/End: Original strand, 21375352 - 21375461
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactg 148  Q
    |||| ||||||||| | ||||||| ||||||  ||| ||||||||||||| |||||||||||| | |||||||||  || ||||| ||| ||||||||      
21375352 aatatcgggttcgactcccaaggg-aacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaacca 21375450  T
149 gtgcgaaagcc 159  Q
    |||||||||||    
21375451 gtgcgaaagcc 21375461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 48 - 122
Target Start/End: Complemental strand, 35006843 - 35006769
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtc 122  Q
    ||||||||||||| ||| | |  |||||||||| |||| ||||| ||||||||||||||| ||||||||||||||    
35006843 gaataccgggttccattccgagagggaacaacgcttggtcagtgtgcatgcctctacgcacgagccagattagtc 35006769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 71 - 145
Target Start/End: Complemental strand, 35245091 - 35245017
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||||| ||| |||||| |||||| |||||||||||||| ||||||| || |||||||| ||| |||||||    
35245091 gggaacaacgtttgaccagtgtgcatgcttctacgcatgagcctgattagttgcccacctttgatggttcggaaa 35245017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 5 - 97
Target Start/End: Original strand, 16755016 - 16755109
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    ||||||| |||||||||||| ||| ||||||  ||||| ||||||||||| ||||||||||| || | | ||||||  ||||||||||||||||    
16755016 ttgggcttcagtggcaaggagctctttccaaagacgtatccggggaatactgggttcgattttcaggagaaacaacacttggccagtgcgcatg 16755109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 49 - 146
Target Start/End: Original strand, 20228717 - 20228814
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||| |||||||||| | ||||| ||||| | ||||| |||||| |||||||||| || ||| |||||||||||| || ||||||||| || |||||    
20228717 aatacagggttcgattcctaagggaaacaatgcttggctagtgcgtatgcctctacacacgagtcagattagtcgcccatctttggtggatcagaaac 20228814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 70 - 159
Target Start/End: Original strand, 20590020 - 20590109
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| |||||||||||||||| |||||||||||||||  |||||| |  |||  |||| || |||||||| |||||| |||||    
20590020 ggggaacaacgcttggccagtgcgcatgactctacgcatgagccgtattagttgtccactattggaggatcggaaaccggtgcggaagcc 20590109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 82 - 158
Target Start/End: Original strand, 22295249 - 22295325
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||||||||||||||||||   ||||||||||| | ||||||| |||| ||||  | |||||||||    
22295249 ttggccagtgcgcatgcctctacgcatgagttggattagtcgcttatctttggtaggtcagaaatcgatgcgaaagc 22295325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 73 - 145
Target Start/End: Original strand, 24875369 - 24875441
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||| ||| |||||||||||| ||||||||| ||||| ||||| |||  |||||||| |||||||||||    
24875369 gaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa 24875441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 56 - 159
Target Start/End: Complemental strand, 22655257 - 22655155
Alignment:
56 ggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    ||||||||| ||| ||| ||||| | |||  ||||| |||||||||||||||| || |||||||||||  ||||||| |||||||| ||||  |||||||    
22655257 ggttcgattcccaggggaaacaatgtttgatcagtgtgcatgcctctacgcataagtcagattagtcgtccaccttt-gtgggtcgaaaaccagtgcgaa 22655159  T
156 agcc 159  Q
    ||||    
22655158 agcc 22655155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 25510438 - 25510481
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc 44  Q
    ||||||||| |||| |||||||||||||||||||||||||||||    
25510438 ttgtttgggttccaatggcaaggaactccttccaagaacgtacc 25510481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 146
Target Start/End: Original strand, 20223020 - 20223150
Alignment:
14 agtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    ||||||||||| ||||||||||  ||||| | |||||||| ||||||||||| ||  |||| |  || |||||||||||  |||||||||| |||||||     
20223020 agtggcaaggagctccttccaaagacgtatctggggaatatcgggttcgattccctgggggga--ac-attggccagtgaacatgcctctaggcatgagt 20223116  T
113 cagattagtcgctcacctttggtgggtcggaaac 146  Q
    || ||||||||  ||||||| || ||||||||||    
20223117 caaattagtcgtccacctttagtaggtcggaaac 20223150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 69 - 159
Target Start/End: Original strand, 25452945 - 25453034
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| | ||| |||||| ||||||||||||||| ||||| |||||||||| || |||| || ||||| |||| ||||| ||||||    
25452945 aggggaacaatgtttgaccagtgtgcatgcctctacgcacgagccggattagtcgc-caactttagtcggtcgaaaaccggtgcaaaagcc 25453034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 58 - 112
Target Start/End: Original strand, 25467419 - 25467473
Alignment:
58 ttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    |||||||| || | ||||||||||||||||||| |||||||||||||||| ||||    
25467419 ttcgattttcaggaggaacaacgattggccagtacgcatgcctctacgcacgagc 25467473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 60 - 146
Target Start/End: Original strand, 32874798 - 32874884
Alignment:
60 cgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| |||||||||||||| ||| | ||||||||| ||| |||||| |||||  |||| |||  |||| ||||||||||||||||    
32874798 cgattttcaaggggaacaacgcttgactagtgcgcatacctttacgcacgagccgaattaatcgtccaccattggtgggtcggaaac 32874884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 47 - 136
Target Start/End: Original strand, 20705561 - 20705650
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtg 136  Q
    |||||| ||| ||| |||| || || |||||||| |||| |||||||||||||||||||||| || ||||||| ||| ||| | ||||||    
20705561 ggaatatcggattcaattttcagggagaacaacgtttggtcagtgcgcatgcctctacgcataaggcagattaatcgttcatcattggtg 20705650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 48 - 97
Target Start/End: Original strand, 40060295 - 40060344
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    |||||||||||||||||| || ||||||||||  ||||||||||||||||    
40060295 gaataccgggttcgattttcagggggaacaacacttggccagtgcgcatg 40060344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 145
Target Start/End: Original strand, 19839327 - 19839423
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||| ||| |||| || | ||||||||| |||  ||||||||||||||||||  | ||| ||||||||||||  |||||| ||| ||||||||    
19839327 aataccggattcaattttcaggaggaacaacgcttgatcagtgcgcatgcctctacatacgagtcagattagtcgcctacctttagtgagtcggaaa 19839423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 93 - 157
Target Start/End: Complemental strand, 27648488 - 27648424
Alignment:
93 gcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||| ||||||| |||||||||  || ||||||||| |||||||| | ||||||||    
27648488 gcatgcctctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaaag 27648424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 159
Target Start/End: Original strand, 40773315 - 40773383
Alignment:
91 gcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||  | ||| | ||||||||| ||| |||||||| ||||||||| ||||||||||||    
40773315 gcgcatgcctctacatacgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaagcc 40773383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 35638189 - 35638066
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| | | ||| |||||||||||||||| | |||||   ||||||||  |  |||||||| || | ||||||||| |||| ||||| |||| ||    
35638189 ttgtttgggattctgtgacaaggaactccttccagggacgtatttggggaatattgaattcgattttcaggaggaacaacgtttggtcagtgtgcatacc 35638090  T
100 tctacgcatgagccagattagtcg 123  Q
    |||||||| ||| |||||||||||    
35638089 tctacgcacgagtcagattagtcg 35638066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 36783296 - 36783353
Alignment:
102 tacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||| |||||||||  |||| ||||||||| |||||| ||||| ||||||    
36783296 tacgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcaaaagcc 36783353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 1826808 - 1826932
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaag-gggaacaacgattggccagtgcgcatgc 98  Q
    ||||||||||| |||| |||| || ||||||||||  |||||| ||||||||| | |||||||||  || | || ||||||| ||||||| ||| |||||    
1826808 ttgtttgggcttcagtagcaatgagctccttccaaagacgtactcggggaatatcaggttcgattctcaggaggaaacaacgcttggccactgcacatgc 1826907  T
99 ctctacgcatgagccagattagtcg 123  Q
    ||||  ||| ||  |||||||||||    
1826908 ctctgagcacgaatcagattagtcg 1826932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 73)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 48804640 - 48804794
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||  ||||||||||||||||||||||    
48804640 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccaaggggaacaacacttggccagtgcgcatgcctcta 48804739  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| |||||||||  |||| |||||||||||||||| |||||||||||    
48804740 cgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 48804794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 13095815 - 13095970
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||||||||| |||||| |||| ||||||| |||||||||||||||| ||| ||| ||||||||||  ||||||||||||||||||||||    
13095815 ttgggctcccgtggcaaggagctcctttcaaggacgtacccggggaataccgggttctattcccagggggaacaacacttggccagtgcgcatgcctcta 13095914  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||    
13095915 cgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagcc 13095970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 27028232 - 27028389
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||| |||||||||| ||| ||||||||||||||| ||||| |||| ||||||||||||| ||||||||||  ||||||||||||||||||    
27028232 ttgtttggactccggtggcaaggagctcattccaagaacgtacctgggaaataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcc 27028331  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| |||||||  |||||||||||||||||||||||||||||||| ||||||||||    
27028332 tctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 34659179 - 34659337
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||| | | ||||| ||||||||||||||||||||  |||||||||||||| ||| ||||||||||||||    
34659179 ttgtttgggctccagtggcaaggagctccttccagggatgtacccggggaataccgggttcgattctcaaggggaacaacgcttgaccagtgcgcatgcc 34659278  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| |||||||||| |||| |||||| |||| |||| |||||||||||    
34659279 tctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcgaaagc 34659337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 29 - 157
Target Start/End: Complemental strand, 38578995 - 38578866
Alignment:
29 cttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctca 127  Q
    |||||||| ||||||| |||||||| ||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| ||    
38578995 cttccaaggacgtacccggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgccca 38578896  T
128 cctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||||||| ||||||||||    
38578895 cctttggtgggtcggaaaccggtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 26423443 - 26423288
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| ||||||||||||| |||||||   |||||||||||||||||| ||| ||| ||||||| ||||||||||| | ||||    
26423443 ttgtttgggctccagtggcaagaaactccttccaaggacgtacccaaggaataccgggttcgattcccaggggaaacaacgcttggccagtgcacctgcc 26423344  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||| ||||||||||||||| ||||||||||| |||||||||| |||||||||    
26423343 tctacgcacgagccagattagtcgttcacctttggt-ggtcggaaaccggtgcgaaa 26423288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 1605894 - 1606053
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||| || |||||| ||||||||||| ||||||| || ||||||| ||||||||||||| ||||||||||| ||||||||||| ||||||    
1605894 ttgtttggactccaatgacaaggagctccttccaaggacgtacccggagaatacctggttcgatttccagggggaacaacgcttggccagtgcacatgcc 1605993  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| || |||||| |||||||||| |||||||||||| |||||||| ||||||||||||    
1605994 tctaggcttgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaagcc 1606053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 22973920 - 22974079
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| | |||| |||| ||||||||||| |||||| |||||||||||||||||||||  || ||||||||||| |||||||||| ||||||     
22973920 ttgtttgggctctaatggcgaggagctccttccaaggacgtactcggggaataccgggttcgattctcagggggaacaacgcttggccagtgtgcatgcg 22974019  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||||||  ||||||||||||||| ||||| || |||||||||    
22974020 tctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccggcgcgaaagcc 22974079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 22993519 - 22993364
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||| ||||||||||| ||||||| |||||||| ||||||||||| | | | ||||||||| |||||||||| |||||||||||    
22993519 ttggactccagtggcaaggagctccttccaaggacgtacccggggaatatcgggttcgattccgaggaggaacaacgcttggccagtgtgcatgcctcta 22993420  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| || || |||||||||||||||||||||||||| ||||| ||||||||||||    
22993419 cgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaagcc 22993364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 43862128 - 43861969
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| || |||||||| ||| ||||||  ||||| | |||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||    
43862128 ttgtttgggctctagcggcaaggagctctttccaaagacgtatctggggaataccgggttcgattcccagggggaacaacgtttggccagtgcgcatgcc 43862029  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||||||  ||||||||||||| ||| |||| ||||||||||||    
43862028 tctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcgaaagcc 43861969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 10048023 - 10047873
Alignment:
10 ctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    ||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| ||||||||||  |||||||||||||| ||||||||||||    
10048023 ctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcat 10047924  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||   ||||||||  |||| |||||||||||||||| ||||||||||||    
10047923 gagcagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 10047873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 6 - 159
Target Start/End: Original strand, 16802081 - 16802235
Alignment:
6 tgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||||||||||||||| || ||||||||||| ||||||| |||||||||||| |||||||   | | |||||||||||||||||||||| ||||||||||    
16802081 tgggctccagtggcaatgagctccttccaaggacgtacccggggaataccggattcgattcttaggaggaacaacgattggccagtgcgtatgcctctac 16802180  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||| ||||| ||||||||||||||| ||||||||||| |||||||||| ||||||    
16802181 gcacgagccggattagtcgctcaccattggtgggtcgaaaactggtgcaaaagcc 16802235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 6 - 155
Target Start/End: Original strand, 18785627 - 18785777
Alignment:
6 tgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    ||||||||||||||||| | ||||||||||| ||||||| |||||||||||||||||||| | | ||||||||||  |||||||||||||||||||||||    
18785627 tgggctccagtggcaagaagctccttccaaggacgtacccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcctctac 18785726  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||||| |  ||||||||| |||||| ||||||||||||||| ||||||||    
18785727 gcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcgaa 18785777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 5069971 - 5069812
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| || |||| ||| ||||||| ||||| |||||||||||||||||| | ||||||||| || || |||| |||||||    
5069971 ttgtttgggctccagtggcaaggagcttcttctaaggacgtacccgggaaataccgggttcgatttccaggaggaacaacgcttagctagtgtgcatgcc 5069872  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||  |||| |||||||||| ||||||||||||||||||||| | ||||||||||    
5069871 tctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagcc 5069812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 17748538 - 17748379
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||| | || |||||||| |||||  ||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||    
17748538 ttgtttgggctctagtggcaagcagcttcttccaaggacgtattcggggaataccgggttcgattcccagggggaacaacgcttggccagtgcgcatgcc 17748439  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| | ||||| |||||||||  |||||||| |||||||||||| | ||||||||||    
17748438 tctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaagcc 17748379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 47341833 - 47341988
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||| ||||||| ||||||| ||||||||||| |||||||| ||| ||||||||||  ||||||||||||||||||||||    
47341833 ttgggctccagtggcaaggagctcattccaaggacgtacccggggaataccgagttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 47341932  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||  |||| |||| ||||| |||||||||||||||  ||||||||||||    
47341933 cgcacgagcaggattggtcgttcaccattggtgggtcggaaatcggtgcgaaagcc 47341988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 43346935 - 43346777
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||  ||||| | |||||||||||||||| |||  |||||||||||||  |||||| |||||||||||    
43346935 ttgtttggactccagtggcaaggagctccttccaaagacgtatctggggaataccgggttcaattctcaaggggaacaacacttggccggtgcgcatgcc 43346836  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| | ||||| ||||||||||||| ||||||||||||||||||  ||||||||||    
43346835 tctacgtacgagccggattagtcgctcatctttggtgggtcggaaaccagtgcgaaagc 43346777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 21530708 - 21530860
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||||||||||| ||||||||||| ||||||| ||||||||| ||||| |||| ||| ||||||||||  |||| |||||| |||||||||||||    
21530708 ggctccagtggcaaggagctccttccaaggacgtacctggggaatactgggtttgattcccagggggaacaacacttggtcagtgcacatgcctctacgc 21530807  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    | |||||  |||| |||||||||||||||||||||||||| ||| ||||||||    
21530808 acgagccgaattaatcgctcacctttggtgggtcggaaaccggttcgaaagcc 21530860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 14650270 - 14650429
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||| ||||||||||| ||||||||||| ||||||| || ||||| ||||||||||||||| | ||||||| | ||| |||||||  |||||    
14650270 ttgtttggactctagtggcaaggagctccttccaaggacgtacccggagaatatcgggttcgatttccaggaggaacaatgcttgaccagtgcatatgcc 14650369  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| | ||||||||||||||||||||||| | |||| ||||||||||||    
14650370 tctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccggtgcgaaagcc 14650429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 45960158 - 45960007
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    ||||||| |||||||| ||||||| ||| ||||||| ||||| |||||||||||| ||| |||| ||||||| ||||||  |||| ||||||||||||||    
45960158 ttgtttgagctccagtagcaaggagctctttccaaggacgtatcggggaataccgagtttgattcccaagggcaacaacacttggtcagtgcgcatgcct 45960059  T
101 ctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||||||| |||| ||||||||||||||||||| ||| |||||||| |||||    
45960058 ctacgcataagccggattagtcgctcacctttgatggatcggaaaccggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 4195354 - 4195200
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||| ||||| ||||| ||||||||||||| |||||||||||| | ||||||||  ||||| ||||||||||||||||    
4195354 ttgggctccagtggcaaggagctcctgccaaggacgtatccggggaataccgagttcgatttccaggaggaacaacatttggctagtgcgcatgcctcta 4195255  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| |||||| ||  |||| ||||||||| |||||| | |||||||||    
4195254 cgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaagc 4195200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 8734842 - 8734684
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||  |||||||||||| ||||||||||| || || |  ||||||| | |||||||||||   ||||||||| | |||| |||||||||||||    
8734842 ttgtttgggcgtcagtggcaaggagctccttccaaggacatatctcgggaatatcaggttcgatttcttgggggaacaatgcttgggcagtgcgcatgcc 8734743  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    || ||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||    
8734742 tcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 8734684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 43925469 - 43925611
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| ||||||||||  |||| |||||||||||||||||    
43925469 ttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctcta 43925568  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||  ||||||| | | ||||||| ||| || |||||    
43925569 cgcatgagctggattagttgtttacctttgatggatcagaaac 43925611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 1797417 - 1797572
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| ||| |||||||||||||||||| ||| ||| ||||||| |||||||||||||||| |||||    
1797417 ttgggctccagtggcaaggagctccttccaaggacgtatccgaggaataccgggttcgattcccaggggaaacaacgcttggccagtgcgcatgtctcta 1797516  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| || ||||||  || ||||| ||| ||| |||| ||||| ||||||    
1797517 cgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtgcaaaagcc 1797572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 4228907 - 4228769
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||| |||||||| ||||||||||| ||||| ||| |||||||| |||||||||||||   ||||||||| ||||||||||| ||||||    
4228907 ttgtttgggctccagcggcaaggagctccttccaaggacgtatccgaggaataccaggttcgatttcca---ggaacaacgtttggccagtgcacatgcc 4228811  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcg 141  Q
     ||||||||||||| |||||||||| |||| ||| |||||||    
4228810 cctacgcatgagccggattagtcgcccaccattgatgggtcg 4228769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 139
Target Start/End: Complemental strand, 19914854 - 19914720
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||||   ||||||| |||||||||| |||| || ||||||| ||||||| ||||||||||||||    
19914854 ttgggctccagtggcaaggagctccttccaaggacgtacctaaggaatactgggttcgattcccaaagg-aacaacgcttggccaatgcgcatgcctcta 19914756  T
104 cgcatgagccagattagtcgctcacctttggtgggt 139  Q
    |||||||||||||||| |||| |||||||| |||||    
19914755 cgcatgagccagattaatcgcccacctttgatgggt 19914720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 42032049 - 42032195
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||| ||||| | ||||||||||| ||||||| |||||||||| ||||||||| ||| ||||||||||| ||||||||||| ||| |     
42032049 ttgtttgggctccagtagcaagaagctccttccaaggacgtacccggggaatacctggttcgattcccacggggaacaacgtttggccagtgcacataca 42032148  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||||||  |||||| |  |||||||| ||||||||||||    
42032149 tctacgcatgagccgaattagttgtccacctttgatgggtcggaaac 42032195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 27875243 - 27875088
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| | |||||||||||| |||| | |||||||||||| ||||||| ||| |||||| |||  ||||||||||| ||||||    
27875243 ttgtttgggctccagtggcaagtagctccttccaaga-cgtatctggggaataccggattcgattcccagggggaataacacttggccagtgcacatgcc 27875145  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||||| |  ||||||||  ||||||| |||||||| |||| |||||||||    
27875144 tctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaaa 27875088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 4 - 154
Target Start/End: Original strand, 14535247 - 14535398
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||||||||| |||||| |||||||||||||| |||||| | ||||||||||||||  |||| || || |||||||  |||||||||| ||||||||||    
14535247 tttgggctccaatggcaaagaactccttccaaggacgtactccgggaataccgggtttcattttcagggagaacaacacttggccagtgtgcatgcctct 14535346  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    ||||| ||||  |||||||||| |||| ||| |||||| |||||||||||||    
14535347 acgcacgagctggattagtcgcccaccattgatgggtcagaaactggtgcga 14535398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 23658133 - 23658291
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||| ||| |||||||  ||||||| |  |||||||||||| ||||||||||| |||||||||| |||||||    
23658133 ttgtttgggctccagtggcaaggagctccttc-aaggacgtacccagggaatatccagttcgatttccagggggaacaacgcttggccagtgtgcatgcc 23658231  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| || ||||| |||||||||  || |||||||||||| |||||  |||| ||||||    
23658232 tctacacacgagccggattagtcgtccatctttggtgggtcagaaacctgtgcaaaagcc 23658291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 39420795 - 39420949
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| |||||| |||| | ||||| |||||||||||| ||||| | |||| |||||||||| ||||||||||||| ||||||||    
39420795 ttgggctctagtggcaaggagctcctttcaaggaggtacccggggaataccgg-ttcgaatcccaaagggaacaacgcttggccagtgcgcgtgcctcta 39420893  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||||||||   ||||||| |||| ||||||| ||||| ||||||    
39420894 cgcatgagccggattagtcgtctacctttgatgggccggaaaccggtgcaaaagcc 39420949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 42210409 - 42210259
Alignment:
10 ctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    ||||||||||||||| ||| ||||||| ||||| ||| |||||||||| ||||||| |||  |  ||||||| ||||||||||||||||||||||||||     
42210409 ctccagtggcaaggagctctttccaaggacgtatccgaggaataccggcttcgattcccagtgaaaacaacgtttggccagtgcgcatgcctctacgcac 42210310  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| ||||| || | |||| |||||||||||||||| | ||||||||||    
42210309 gagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagcc 42210259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 45 - 159
Target Start/End: Complemental strand, 48244467 - 48244353
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||||||||| ||||| ||||||||||| | |||  |||||||  |||||||||||||||||| ||||||||||||||||||||||| ||| ||    
48244467 ggggaataccgggttcaatttctaaggggaacaatgcttgatcagtgcgtttgcctctacgcatgagccggattagtcgctcacctttggtggatcgaaa 48244368  T
145 actggtgcgaaagcc 159  Q
    || ||||||||||||    
48244367 accggtgcgaaagcc 48244353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 22268185 - 22268039
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||| ||||||| ||||||  |||||||||||||||||||| ||| ||||||||||  |||||||||||||||| |    
22268185 ttgtttgggctccagtggcaaggagctcattccaaggacgtacttggggaataccgggttcgattcccagggggaacaacatttggccagtgcgcatgac 22268086  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |            ||||||||||||||||||||||||| |||||||| |||||||||||    
22268085 t------------cagattagtcgctcacctttggtggatcggaaaccggtgcgaaagc 22268039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 4 - 140
Target Start/End: Complemental strand, 36619407 - 36619270
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||| ||| |||||||||||||||||| |||| |||||   |||||||||||||||||||| ||| ||||||||||  ||| |||||| ||||||||||    
36619407 tttggactctagtggcaaggaactccttgcaaggacgtatttggggaataccgggttcgattcccagggggaacaacacttgtccagtgtgcatgcctct 36619308  T
103 acgcatgagccagattagtcgctcacctttggtgggtc 140  Q
    ||||||||||| |||||||||  |||| ||||||||||    
36619307 acgcatgagccggattagtcgtccaccattggtgggtc 36619270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 5039574 - 5039422
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||||||||   | |||  |||||||||||| |||||||| | | | ||||||||  |||| |||||| ||| ||    
5039574 ttgtttgggctccagtggcaaggagctccttccatagatgtattcggggaataccgagttcgattcctaggaggaacaacacttggtcagtgcacatacc 5039475  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||||||||||||| ||||||||||||||||||||||| ||| |||| |||||    
5039474 tctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgc 5039422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 43 - 158
Target Start/End: Complemental strand, 10317858 - 10317744
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||||||||||||||| ||| |||||| |||  |||| ||||||| ||||||||| |||| ||| |||||||||||||||||||||||| ||||    
10317858 ccggggaataccgggttcgattcccagggggaataacacttggtcagtgcgtatgcctctatgcataagc-agattagtcgctcacctttggtggatcgg 10317760  T
143 aaactggtgcgaaagc 158  Q
    |||| |||||||||||    
10317759 aaaccggtgcgaaagc 10317744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 45 - 159
Target Start/End: Complemental strand, 49142780 - 49142666
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||||||||||||| | | ||||||||||| || |||||||| |||||||||||||| ||||| ||||||| || |||||||| ||||||| ||    
49142780 ggggaataccgggttcgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaa 49142681  T
145 actggtgcgaaagcc 159  Q
    | |||||||||||||    
49142680 attggtgcgaaagcc 49142666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 39474892 - 39475051
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc--ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgc 98  Q
    |||||||| ||| ||||| ||||| ||| ||||||  ||||| |  |||| ||||||||||||||| | | ||||||||||| |||| |||||||||| |    
39474892 ttgtttggactctagtggtaaggagctctttccaaagacgtatccgggggtataccgggttcgattcctatggggaacaacgcttggtcagtgcgcatac 39474991  T
99 ctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||| |||||||||  ||||||| |||||||| ||||  ||||||||||    
39474992 ctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcgaaagc 39475051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 45447927 - 45448069
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||| || ||||||||||| ||||||||||| ||||||| | ||| |||| ||||||||||||| || |||||||| ||||| ||||||||| ||||||    
45447927 ttgggttctagtggcaaggagctccttccaaggacgtacccgagaaataccaggttcgatttccagggagaacaacgcttggctagtgcgcatccctcta 45448026  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    | ||  || |||||||||| | ||||||| |||||||||||||    
45448027 cacactagtcagattagtcacccacctttagtgggtcggaaac 45448069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 26 - 158
Target Start/End: Complemental strand, 21190911 - 21190778
Alignment:
26 ctccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    ||||||||||| || || |||||||||||||||||||||| | | | ||| ||||| ||||| |||||||||||||||||||| ||| ||||||||||||    
21190911 ctccttccaaggacttatccggggaataccgggttcgattcctaggaggagcaacgcttggctagtgcgcatgcctctacgcacgagtcagattagtcgc 21190812  T
125 tcacctttggtgggtcggaaactggtgcgaaagc 158  Q
     || |  |||||||||| |||| |||||||||||    
21190811 ccatcaatggtgggtcgaaaaccggtgcgaaagc 21190778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 37514874 - 37515031
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| || || || |||| | ||||||||||| || |||| ||||||||| ||||||||||| ||  |||||||||| |||| ||||||||||| |    
37514874 ttgtttggacttcaatgacaagtagctccttccaaggacatacccggggaatactgggttcgattttcagtgggaacaacgtttggtcagtgcgcatgtc 37514973  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||| ||||| ||| ||||| || ||||||||||||| |||| |||||    
37514974 tctacgcacgagccggattaatcgttcaccattagtgggtcggaaaccggtgtgaaag 37515031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 24969480 - 24969324
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||  || |||| ||||| | || || ||||||||||||||||||  |||||||||  ||||||||||||| ||||    
24969480 ttgtttgggctccagtggcaaggagcttttttcaaggacgtatctggaaaataccgggttcgatttcca--gggaacaacacttggccagtgcgcgtgcc 24969383  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| |  || | ||||| ||||||| ||||| ||| |||||||| |||||||||||    
24969382 tctacgtacaagtcggattaatcgctcatctttgatggctcggaaaccggtgcgaaagc 24969324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 365097 - 365250
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||| || || |||||||||| |||||| ||| ||||||||||||||||||  || | ||||||||| ||   |||||||||||||||||    
365097 ttgggctctagtggtaaagagctccttccaaaaacgtatccgaggaataccgggttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctcta 365196  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| |||||||  | ||||  |||||||||| |||| | ||||||||    
365197 cgcatgagcctgattagtgacccaccagtggtgggtcgaaaaccgatgcgaaag 365250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 42 - 157
Target Start/End: Original strand, 3603348 - 3603467
Alignment:
42 accggggaataccgggttcgatttccaaggggaacaacgattggcc----agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgg 137  Q
    |||||||||||||||||||||||     ||||||||||| ||||||    |||||||||||||||||||| ||||| ||||| ||| |||| ||||||||    
3603348 accggggaataccgggttcgattctttgggggaacaacgtttggccggtcagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgg 3603447  T
138 gtcggaaactggtgcgaaag 157  Q
    ||||||||  ||||||||||    
3603448 gtcggaaatcggtgcgaaag 3603467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 71 - 157
Target Start/End: Original strand, 41945497 - 41945583
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| |||| |||||||||||||||||||||||||| ||||| |||||||||  ||||||||||| ||||||||  ||||||||||    
41945497 gggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag 41945583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 73 - 159
Target Start/End: Original strand, 48551883 - 48551969
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||||| |||||||||||||||| ||||||| |||||||||  |||||||| ||| |||||||| ||||||||||||    
48551883 gaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagcc 48551969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 70 - 159
Target Start/End: Original strand, 28744185 - 28744274
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||| | ||||||||| ||||| |||||||  | ||||| |||||||||  ||||||||||||||||||||||||||||||||||    
28744185 ggggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagcc 28744274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 33 - 146
Target Start/End: Complemental strand, 28396284 - 28396170
Alignment:
33 caagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctt 131  Q
    |||||||||| ||||| |||| ||||||| |||  || ||||||||||| || ||  |||||||||||| |||||||||||| |||||||||   |||||    
28396284 caagaacgtatccgggaaatatcgggttcaattctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctt 28396185  T
132 tggtgggtcggaaac 146  Q
    |||||||||||||||    
28396184 tggtgggtcggaaac 28396170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 57 - 159
Target Start/End: Original strand, 32823253 - 32823355
Alignment:
57 gttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||| ||| ||||||||||  |||||| ||| | ||||||||||||| ||||| ||||||||||  ||| ||| |||||||||||| |||||||||    
32823253 gttcgattcccagggggaacaacacttggccggtgtgtatgcctctacgcacgagccggattagtcgcagaccattgatgggtcggaaacgggtgcgaaa 32823352  T
157 gcc 159  Q
    |||    
32823353 gcc 32823355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 29805595 - 29805439
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||| |||||  ||||| |||| |||||  ||| |||||||| |||||||| |  | |||||||||| |||| ||||||||||| |    
29805595 ttgtttggactccagtggtaaggagatcctttcaaggacgtattcggagaataccgagttcgatt-catatgggaacaacgtttggtcagtgcgcatgtc 29805497  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||| |||| |||   |||||| ||| |||||||||  |||||||||    
29805496 tctacgcatgagccaaattaatcgtctacctttagtgagtcggaaaccagtgcgaaag 29805439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 69 - 157
Target Start/End: Original strand, 3353446 - 3353534
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||||  |||||||||||||||||||||||||| ||||| |||||||||  |||||||| ||| || ||||| ||||||||||    
3353446 agggaaacaacatttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaag 3353534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 9685692 - 9685756
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    |||||||||||||||||||||||| ||||||||||| ||||| |||||||||| |||||||||||    
9685692 ttgtttgggctccagtggcaaggagctccttccaagcacgtatccggggaatatcgggttcgatt 9685756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 5 - 64
Target Start/End: Complemental strand, 34127772 - 34127712
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    |||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||    
34127772 ttgggctccaatggcaaggaactccttccaaggacgtacccggggaataccgggttcgatt 34127712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 29151893 - 29152052
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||| ||| ||  ||||| || | ||||||| | |||||||||||||||||| ||| |  |||||||| ||| ||||||||||||||    
29151893 ttgtttgggctctagtgacaatgagttcctttcatggacgtacctgaggaataccgggttcgattcccaggaagaacaacgtttgaccagtgcgcatgcc 29151992  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| || || || ||||| |||   ||| ||| |||||||||||| | ||||||||||    
29151993 tctacacacgatccggattaatcgtctaccattgatgggtcggaaaccgatgcgaaagcc 29152052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 4973266 - 4973110
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| || |||||| || |||||||| || ||  ||||||||| ||||||||||| | | |||||| |||  ||| ||| ||||||||||    
4973266 ttgtttgggctccactgacaaggagcttcttccaaggacttattcggggaatatcgggttcgattcctacggggaataacacttgaccaatgcgcatgcc 4973167  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||| | ||||| |||||||||  || |||||||| | | ||||||||||| ||||    
4973166 tctacgtacgagccggattagtcgtccagctttggtgag-cagaaactggtgcaaaag 4973110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 46 - 123
Target Start/End: Original strand, 30827291 - 30827368
Alignment:
46 gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcg 123  Q
    ||||||||| |||||||||| || || |||||||  ||||||||| |||||||||||||||| ||||| |||||||||    
30827291 gggaataccaggttcgattttcagggagaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcg 30827368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 45 - 157
Target Start/End: Original strand, 22573811 - 22573922
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||| |||||||||||| || ||||||||||  ||| ||||||||||||||| |||||||||||| ||||| |||  || | ||| ||||| | ||    
22573811 ggggaatatcgggttcgattttca-ggggaacaacatttgaccagtgcgcatgcctttacgcatgagccggattaatcgtccatcattgatgggttgaaa 22573909  T
145 actggtgcgaaag 157  Q
    || ||||||||||    
22573910 accggtgcgaaag 22573922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 88 - 159
Target Start/End: Complemental strand, 24983487 - 24983415
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtc-ggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||||||||| |||||||||  |||| |||||||||| |||||| | ||||||||||    
24983487 agtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaagcc 24983415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 82 - 154
Target Start/End: Original strand, 38988935 - 38989006
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    |||| |||||| ||||||||||||||||| || ||||||||||||| |||||||||||| ||||| |||||||    
38988935 ttggtcagtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtgggtc-gaaaccggtgcga 38989006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 45853676 - 45853565
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| |||| |||||||||||||||||||||||| |||||   || |||| ||| ||||||||||||  || ||||||||||||||| |  | ||| |    
45853676 ttgtttaggcttcagtggcaaggaactccttccaaggacgtatttggagaatgccgagttcgatttccagtggaaacaacgattggccattatgaatgac 45853577  T
100 tctacgcatgag 111  Q
    ||||||||||||    
45853576 tctacgcatgag 45853565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 5 - 122
Target Start/End: Original strand, 11607088 - 11607205
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||||||||||||||| |||||  ||||||||| ||| ||||| |||   ||||||||||  ||  ||||||| |||| |||||    
11607088 ttgggctccagtggcaaggaactccttccaaggacgtattcggggaatatcggattcga-ttctctggggaacaacacttaaccagtgcacatgactcta 11607186  T
104 cgcatgagccagattagtc 122  Q
    | || |||| |||||||||    
11607187 cacacgagctagattagtc 11607205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 94 - 159
Target Start/End: Original strand, 32768984 - 32769049
Alignment:
94 catgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||| | ||||||||| ||||||||||||| |||||||| |||| |||||||    
32768984 catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagcc 32769049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 69 - 146
Target Start/End: Complemental strand, 45697277 - 45697200
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||||  |||  |||||||||||||||||||||||||   | |||||||  |||||||||||||||||||||    
45697277 aggggaacaacacttgatcagtgcgcatgcctctacgcatgagttgggttagtcgtccacctttggtgggtcggaaac 45697200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 46414628 - 46414741
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| |||||||||| ||||||  ||| ||||||| | ||||||||  ||||||||  || |  ||| |||| ||||||| ||||||||||    
46414628 ttgtttgggctcccgtggcaaggagctccttttaaggacgtacccgtggaataccaagttcgattctcaggatgaataacgcttggccaatgcgcatgcc 46414727  T
100 tctacgcatgagcc 113  Q
    |||||||| |||||    
46414728 tctacgcacgagcc 46414741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 4706140 - 4706005
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||| |||||||||| ||||||||||  ||||| |  |||| |||  ||||||||||  | ||||||||||| || |||| | |||||||     
4706140 ttgtttggactccggtggcaaggagctccttccaatgacgtatctaggaaatacatggttcgatttttagggggaacaacgtttagccattacgcatgct 4706041  T
100 tctacgcatgagccagattagtcgctcacctttggt 135  Q
    |||||||| ||||  |||||||||  ||||||||||    
4706040 tctacgcacgagctggattagtcgtccacctttggt 4706005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 88 - 146
Target Start/End: Complemental strand, 41267992 - 41267934
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| |||||||||||||||||||  ||||||||||  |||||||| ||||||||||||    
41267992 agtgtgcatgcctctacgcatgagttagattagtcgtccacctttgatgggtcggaaac 41267934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 82 - 159
Target Start/End: Original strand, 45758322 - 45758397
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||||| |  |||   ||||| |||| |||||||||||||||||||||  |||||||||||    
45758322 ttggccagtgcgcatgcctctacac--gagttggattaatcgcacacctttggtgggtcggaaacccgtgcgaaagcc 45758397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 20247325 - 20247221
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    ||||||||  || ||||||||| | ||||||||||| | ||||  ||||||||| |||||||||  || ||||||||||| |||| |||| | |||| ||    
20247325 ttgtttggaatctagtggcaagaagctccttccaaggatgtacttgggaataccaggttcgattctcatggggaacaacgcttgggcagtacacatgtct 20247226  T
101 ctacg 105  Q
    |||||    
20247225 ctacg 20247221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 14537819 - 14537938
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| | | |||||| ||||||||||  || |||  ||| |||||||  |||||||| |||||| || |||| |||| |||||||||| ||    
14537819 ttgtttgggctcccgcgacaaggagctccttccaatgacatacttgggaaataccgaattcgattttcaagggaaataacgtttggtcagtgcgcatacc 14537918  T
100 tctacgcatgagccagatta 119  Q
    |||| |||| || |||||||    
14537919 tctatgcataagtcagatta 14537938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 158
Target Start/End: Complemental strand, 34127698 - 34127643
Alignment:
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| ||||| |||||||||| |||||||||||||||  |||| |||||||||||    
34127698 acgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtgcgaaagc 34127643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 65 - 137
Target Start/End: Original strand, 23060697 - 23060767
Alignment:
65 tccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgg 137  Q
    |||| ||||||||||| ||| ||| || ||||||||  ||||||||| | ||||||||| |||||||||||||    
23060697 tccagggggaacaacgtttgaccaatgtgcatgcct--acgcatgagtcggattagtcgttcacctttggtgg 23060767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 30 - 146
Target Start/End: Complemental strand, 48224857 - 48224741
Alignment:
30 ttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcac 128  Q
    ||||||| ||||| || ||||||| || |||| ||||||| ||| ||||||| |||  |||||||||||  |||||| ||||| || |||||||  |||     
48224857 ttccaaggacgtatccagggaatatcgagttcaatttccatggg-aacaacgcttgatcagtgcgcatgtatctacgtatgagtcaaattagtccttcat 48224759  T
129 ctttggtgggtcggaaac 146  Q
    ||||||||||||| ||||    
48224758 ctttggtgggtcgaaaac 48224741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 106; Significance: 7e-53; HSPs: 97)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 54261176 - 54261333
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| | | | ||||||||| ||||||||||||||||||    
54261176 ttgtttgggctccagtggcaaggagctccttccaaggacgtacctggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcc 54261275  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| ||||||||| |||||||| ||||||||||||| ||||||||||    
54261276 tctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 15320136 - 15320295
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||| | | ||||||| |||||||||||| |||||||    
15320136 ttgtttggactccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgatttcgaggaggaacaatgattggccagtgtgcatgcc 15320235  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| ||||||||||||||| ||||| ||||||||||||    
15320236 tctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 15320295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 45877404 - 45877561
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| | ||||||||| ||||| |||||||||||||||||||||||||| ||| ||||||  ||||||||||| ||||||    
45877404 ttgtttgggctccagtggcaaggagccccttccaaggacgtatccggggaataccgggttcgatttccaggggaaacaacacttggccagtgcacatgcc 45877503  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| ||||||||| ||||| ||| |||||||||||| ||||||||||    
45877504 tctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaaag 45877561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 29127869 - 29128028
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||||  |||||||||| ||||| | |||||||| ||||||||||||||| || |||||||  |||| |||||||||||||    
29127869 ttgtttgggctccagtggcaaggagatccttccaaggacgtatctggggaatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcc 29127968  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| |||||||||| ||||||||||||||||||||| | ||||||||||    
29127969 tctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagcc 29128028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 48341970 - 48342128
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| ||| | | ||||||||||| ||||| ||||||||||||    
48341970 ttgtttgggctccagtggcaaggagctccttccaaggacgtacctggggaataccgggttctattcctagggggaacaacgcttggctagtgcgcatgcc 48342069  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| ||||||||||||  || ||||||||| |||||||| |||||||||||    
48342070 tctacgcatgaaccagattagtcgtccatctttggtggatcggaaacaggtgcgaaagc 48342128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 30767400 - 30767247
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||  |||||||||| | ||||| |||||||| ||||||||||||||| ||||||||||  |||||||||| |||||||||||    
30767400 ttgggctccagtggcaaggagttccttccaaggatgtacctggggaatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctcta 30767301  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||| |||||||||| |||||||||||||||||||||| |||||||||    
30767300 cgcacgagccggattagtcgcccacctttggtgggtcggaaactagtgcgaaag 30767247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 13893876 - 13894035
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||  ||||||||||||||||| |||||||| ||||||||||| |||| || ||||||||||    
13893876 ttgtttgggctccagtggcaaggagctccttccaaggacgtgtccggggaataccgggttggatttccagggggaacaacgcttggtcaatgcgcatgcc 13893975  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| || ||||| |||||||||| |||||||||||| ||| |||| ||||||||||||    
13893976 tctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcgaaagcc 13894035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 41630669 - 41630510
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| ||||||||| | ||||| ||||  |||||||||||| ||| ||||||||||||||| ||| ||||||||||||||    
41630669 ttgtttgggctccagtgacaaggagctccttccatggacgtaaccggaaaataccgggttcaattcccaaggggaacaacgcttgcccagtgcgcatgcc 41630570  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||| |||||||||| |||||||||| ||||||||||||||| |||||||    
41630569 tctacacatgagccggattagtcgcccacctttggttggtcggaaactggtgtgaaagcc 41630510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 35315906 - 35316063
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||||||||||| ||||||| || ||||| ||||||||||| ||| ||||||||||  ||||||||||||||||||    
35315906 ttgtttgggctccagtggcaaagagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcc 35316005  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||  |||||||||| ||| ||||||||||||||||| | ||||||||    
35316006 tctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 28572360 - 28572209
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||||||||||||||| |||||| |||||||| ||| ||||||||| |||||||||| ||| ||| ||||||| |||||||||  |||||||||||||||    
28572360 gctccagtggcaaggagctcctttcaagaacgcacccggggaatactgggttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgca 28572261  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||| |||||||||| ||||||||||||||||||||| ||||||||||||    
28572260 cgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 28572209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 29135867 - 29136022
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| || |||||||| ||||| |||||||||||||| ||||||| ||| ||||||||||  ||||||||||||||||||||||    
29135867 ttgggctccagtggcaaggagcttcttccaaggacgtatccggggaataccggattcgattcccagggggaacaacacttggccagtgcgcatgcctcta 29135966  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||   |||| ||||||||| |||||| ||| ||||||||    
29135967 cgcatgagccggattagtcttccaccattggtgggttggaaaccggtacgaaagcc 29136022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 9 - 158
Target Start/End: Original strand, 7328802 - 7328951
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||| |||||||||||  |||||||||| ||||||| ||||| |||||||||||||| ||| ||||||||||  ||||||||||||||||||| ||||||    
7328802 gctctagtggcaaggagttccttccaaggacgtacccgggaaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgca 7328900  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| |||||||||| |||||||||||||||| |||| |||||||||||    
7328901 tgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc 7328951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 42412927 - 42412775
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||  ||||||||||| ||||| ||||| ||||||||||    
42412927 ttgggctccaatggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccggggggaacaacgcttggcaagtgcccatgcctcta 42412828  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||||||||||||||    ||||||||||||| ||||| ||||||    
42412827 cgcatgagccggattagtcgctcacc---agtgggtcggaaaccggtgcaaaagcc 42412775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 3136850 - 3136692
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| |||||||| | |||||| |||| ||||||| |||||||||||| |||||||| || ||||||||||  |||| |||||||||||||    
3136850 ttgtttgggctcccgtggcaagaagctcctttcaaggacgtacccggggaataccggattcgattttca-ggggaacaacacttgggcagtgcgcatgcc 3136752  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||| | |||||||||  |||||||||| |||||||||| ||||||||||||    
3136751 tctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaaagcc 3136692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 7310856 - 7310701
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| ||||||| || ||||||||||||||||||| | |||||||||||||||||| |||  |||||||||  ||| || ||| |||||||||||    
7310856 ttgggctccggtggcaatgagctccttccaagaacgtacctgaggaataccgggttcgattcccagtgggaacaacacttgcccggtgtgcatgcctcta 7310757  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| ||||||||||||| |||||||||||||||||| | ||||||||||    
7310756 cgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaaagcc 7310701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 25294914 - 25295069
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| ||||  |  ||| ||||||  ||||||||||||||||||||||    
25294914 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggtttgattctctggggaaacaacacttggccagtgcgcatgcctcta 25295013  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||||||| |||||||||  |||| ||||||||| |||||| ||||||||||||    
25295014 tgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcgaaagcc 25295069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 13 - 159
Target Start/End: Original strand, 47219106 - 47219253
Alignment:
13 cagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||| || || ||| ||||||| ||||| |||||||||||| ||||||||| ||||||| ||||||| ||||| ||||||||||||||||||||||||    
47219106 cagtggtaatgagctctttccaaggacgtatccggggaataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgag 47219205  T
112 ccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    || |||||||||  |||||||| |||||||||||| ||||||||||||    
47219206 ccggattagtcgtccacctttgatgggtcggaaaccggtgcgaaagcc 47219253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 47749261 - 47749103
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||| || || || |||||||| ||||| || ||||||||||||||||||| || |||||||||||  ||||||||||||||||||    
47749261 ttgtttgggctccagtggtaatgagcttcttccaaggacgtatccagggaataccgggttcgatt-cctaggggaacaactcttggccagtgcgcatgcc 47749163  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||  ||||||||| |||||||||| |||||||||| | ||||||||||    
47749162 tctacgcacgagccgaattagtcgcccacctttggtaggtcggaaaccgatgcgaaagcc 47749103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 5 - 154
Target Start/End: Complemental strand, 26207954 - 26207804
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| | ||||| |||||||||||||||||||| ||| ||||||||||| ||| |||||| |||||||||||    
26207954 ttgggctccagtggcaaggagctccttccaaggatgtacccggggaataccgggttcgattcccacggggaacaacgcttgtccagtgtgcatgcctcta 26207855  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    |||||||||| |||||||||  ||   || ||||||||||||| |||||||    
26207854 cgcatgagccggattagtcggccattattagtgggtcggaaaccggtgcga 26207804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 31072828 - 31072986
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| |||||| |||| ||||||| || ||||||| ||||||||||||| ||||||||||| |||| |||||| ||||||    
31072828 ttgtttgggctccaatggcaaggagctcctttcaaggacgtacccggagaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcc 31072927  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| || |||||||| |||  |||||||||| ||| |||||| |||||||||||    
31072928 tctacgcacgacccagattaatcgtccacctttggtaggttggaaaccggtgcgaaagc 31072986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 32873705 - 32873571
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||||||||||||||||||||| ||| ||||||| ||||||| ||||||||| ||||||||| | | || |||||||| ||| ||||||| |||||||    
32873705 ttgtttgggctccagtggcaaggagctcattccaaggacgtacccgggaataccaggttcgattcctagggagaacaacgcttgaccagtgcacatgcct 32873606  T
101 ctacgcatgagccagattagtcgctcacctttggt 135  Q
    ||||| |||||||||||||||||| ||||||||||    
32873605 ctacgtatgagccagattagtcgcccacctttggt 32873571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 49543469 - 49543627
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||  ||||||||||| ||||||||||| ||||| || ||||||| |||||||||||  || ||||||||||| |||| ||||| |||||||    
49543469 ttgtttgggctttagtggcaaggagctccttccaaggacgtatcccgggaatatcgggttcgattctcatggggaacaacgtttggtcagtgtgcatgcc 49543568  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| |||||  ||||||||| ||||||| ||||||||||||||||| |||||||    
49543569 tctacgcacgagccgaattagtcgcccacctttagtgggtcggaaactggtacgaaagc 49543627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 51683111 - 51682955
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||| |||| ||||||||||  ||||| |||||||||||| ||||||||| ||| ||||||||||| ||| ||||||||||||||    
51683111 ttgtttgggctccagtggcgaggagctccttccaaagacgtatccggggaataccaggttcgattcccagggggaacaacgcttgaccagtgcgcatgcc 51683012  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||| | || ||||| |||||||||| ||||  |||||||||||||||  ||||||||    
51683011 tctccacacgagccggattagtcgcccaccaatggtgggtcggaaaccagtgcgaaa 51682955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 7650177 - 7650335
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| ||||||||||||||  ||||| |||| | ||||   ||||||||||||||||||||||| ||||||||||  ||||||||| || ||| |    
7650177 ttgtttgggttccagtggcaaggagttcctttcaaggatgtacttagggaataccgggttcgatttccagggggaacaacacttggccagtacgaatgtc 7650276  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| |||||||||| |||||||||||||| |||||| |||||||||||    
7650277 tctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc 7650335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 156
Target Start/End: Complemental strand, 3507687 - 3507534
Alignment:
5 ttgggctccagtggcaaggaactccttccaa-gaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    |||| ||| ||||||||||| ||||||| || | |||||| | |||||||||||||| |||| | |  |||||||||  |||||||||||||||||||||    
3507687 ttggactctagtggcaaggagctccttcaaaaggacgtacacagggaataccgggtttgattcctagagggaacaacacttggccagtgcgcatgcctct 3507588  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||| ||||| |||||||||||||||||||||||||||||||| |||||||||    
3507587 acgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 153
Target Start/End: Original strand, 10040511 - 10040659
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||| ||| ||||||| |||||||| |||||||||||  || ||||||||||| ||||||||||||||||||||||    
10040511 ttgggctccagtggcaaggagctccttctaaggacgtacccggggaatatcgggttcgattctca-ggggaacaacgcttggccagtgcgcatgcctcta 10040609  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcg 153  Q
    |||| ||||| || | ||||  |||||||||||||| |||||| ||||||    
10040610 cgcacgagccggaatggtcgtccacctttggtgggttggaaaccggtgcg 10040659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 47471786 - 47471938
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| |||||||| || ||||||||||| |||||||  ||||||||||||||||||| ||| ||||||||| | ||||| ||||||||||| ||||    
47471786 ttgggctctagtggcaaagagctccttccaaggacgtacctagggaataccgggttcgattccca-ggggaacaatgcttggctagtgcgcatgcttcta 47471884  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||  ||||||||  ||||||||||||||||||||| | ||||||||    
47471885 cgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 6462366 - 6462518
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||||||||||| ||||| | ||||||||||||||||||||  || || |||||||| ||||||||||||||||||||||    
6462366 ttgggctctagtggcaaggagctccttccaaggacgtatctggggaataccgggttcgattcacagggagaacaacgcttggccagtgcgcatgcctcta 6462465  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||| |||||||||  ||   || |||||| |||||| |||||||||    
6462466 cgcatgagccggattagtcgaccattattagtgggttggaaaccggtgcgaaa 6462518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 33251612 - 33251771
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| ||||||| || ||||||||||| |||||   |||||||||||||||||||| ||   |||||||||| |||||||||| |||||||    
33251612 ttgtttgggctccggtggcaatgagctccttccaaggacgtattaggggaataccgggttcgattcccggtgggaacaacgtttggccagtgtgcatgcc 33251711  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| |||||||||  ||| |||| ||||||| ||||  |||||||||||    
33251712 tctacgcatgagccggattagtcgtccacatttgatgggtcgaaaacgagtgcgaaagcc 33251771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 30045775 - 30045929
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| |||||||| || ||||||  ||||||||||  |||||||||||||||||||| | | ||||||||||| |||||||||||||||| |||||    
30045775 ttgggctcaagtggcaatgagctccttttaagaacgtacatggggaataccgggttcgattcctagggggaacaacgcttggccagtgcgcatgtctcta 30045874  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||| | |||||||||  |||||||| ||||||| ||||| ||||||||||    
30045875 cgcacgagtctgattagtcgtccacctttgatgggtcgtaaactagtgcgaaagc 30045929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 49198301 - 49198447
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| ||||||  | |||||||| || || |||||||||||||||||||||| | | ||||||||||  ||||||||||||||||||    
49198301 ttgtttgggctccagtgacaaggagtttcttccaaggacatatccggggaataccgggttcgattcctagggggaacaacacttggccagtgcgcatgcc 49198400  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||||||| |||||||||  |||| ||||||| || |||||    
49198401 tctacgcatgagccggattagtcgtccaccattggtggatcagaaac 49198447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 50 - 159
Target Start/End: Original strand, 26043812 - 26043921
Alignment:
50 ataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactgg 149  Q
    ||||||||||||||| ||| || |||||||  |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||| ||    
26043812 ataccgggttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccgg 26043911  T
150 tgcgaaagcc 159  Q
     |||||||||    
26043912 ggcgaaagcc 26043921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 29762308 - 29762155
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| | |||  ||||||||| ||||| |||||  || ||| ||||||  ||||||||||||||||||||||    
29762308 ttgggctccagtggcaaggagctccttccaaggatgtattcggggaatatcgggtccgattctcaggggcaacaacacttggccagtgcgcatgcctcta 29762209  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
     ||||||||  |||||||||  |||| |||||||||||||||| ||||||||||    
29762208 tgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 29762155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 4 - 159
Target Start/End: Complemental strand, 26362119 - 26361965
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||| |||||||| ||| || ||||||||||| |||| | | |||||| | |||| |||| ||||||||||||||| |||| ||||| |||||||||||    
26362119 tttggactccagtgacaatgagctccttccaaggacgttc-gaggaatatcaggtttgattcccaaggggaacaacgtttggtcagtgtgcatgcctcta 26362021  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||| |||||||| |||||||||||| |||| |||||||    
26362020 cgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaaagcc 26361965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 51060438 - 51060279
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||  | ||||||||||| |  || |||||||||| |||||||||||  || ||||||||||  |||| |||||||||||||    
51060438 ttgtttggactccagtggcaaatagctccttccaaggatctatccggggaatatcgggttcgattctcagggggaacaacacttggtcagtgcgcatgcc 51060339  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| |  |||||||||  |||| |||||||||||||||| ||||||||||||    
51060338 tctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 51060279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 11687266 - 11687144
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| | ||||||||||| ||||||| || |||||||||||| ||||  || ||||||||| | ||||||||||||||||||    
11687266 ttgtttgggctccagtggcaagaagctccttccaaggacgtacctggagaataccgggtttgattctcagggggaacaatgcttggccagtgcgcatgcc 11687167  T
100 tctacgcatgagccagattagtc 122  Q
    |||||| ||||| ||||||||||    
11687166 tctacgtatgagtcagattagtc 11687144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 55069836 - 55069678
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| ||| || ||| || |||| |||||  | |||||||| ||||| |||| | |  |||||||||| ||||||||||| ||||||    
55069836 ttgtttgggctccagtgacaatgagctcttttcaaggacgtattcagggaatactgggtttgattcctatagggaacaacgtttggccagtgcacatgcc 55069737  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| ||||| |||||||||||||||||||||||||| ||||| |||||    
55069736 tctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgcaaaagc 55069678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 45 - 145
Target Start/End: Original strand, 8164548 - 8164648
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||| |||||| ||| | |||||||||| |||||||||||| ||||||    
8164548 ggggaataccgggttcaatttctaaggggaacaacgcttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtggatcggaa 8164647  T
145 a 145  Q
    |    
8164648 a 8164648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 10855334 - 10855458
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| | ||||  ||||| ||||||||| |||||||| ||||||||||| ||||||||| ||||||||    
10855334 ttgtttgggctccagtggcaaggagctccttccaaggatgtacttgggaaataccgggtttgatttccagggggaacaacgcttggccagtacgcatgcc 10855433  T
100 tctacgcatgagccagattagtcgc 124  Q
    |||||||| || ||  |||||||||    
10855434 tctacgcacgaaccgaattagtcgc 10855458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 5 - 124
Target Start/End: Original strand, 39849026 - 39849145
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||| | ||||||  ||||||||||| ||| | ||||||||| |||||||||| |||||||||||    
39849026 ttgggctccagtggcaaggagctccttccaaggacgtactcagggaatttcgggttcgattccca-gaggaacaacgcttggccagtgtgcatgcctcta 39849124  T
104 cgcatgagccagattagtcgc 124  Q
    |||||||||| ||||||||||    
39849125 cgcatgagccggattagtcgc 39849145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 21 - 156
Target Start/End: Original strand, 53649697 - 53649833
Alignment:
21 aggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatta 119  Q
    |||| ||||||||||| |||||  |||||||||||||||||||||  || || |||||||  ||||||||||||| || ||||||||||||||| |||||    
53649697 aggagctccttccaaggacgtattcggggaataccgggttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggatta 53649796  T
120 gtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||| ||||||||| ||| |||||||| |||||||||    
53649797 gtcgttcacctttgatggatcggaaaccggtgcgaaa 53649833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 53 - 159
Target Start/End: Complemental strand, 24506751 - 24506646
Alignment:
53 ccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    ||||||||||||| || ||| ||||||| ||| ||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||    
24506751 ccgggttcgattttca-gggaaacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgc 24506653  T
153 gaaagcc 159  Q
     ||||||    
24506652 aaaagcc 24506646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 5 - 155
Target Start/End: Original strand, 8362536 - 8362682
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||||||||||| ||||||||||||||| ||| |     ||||||||||||||||| ||| |||  || ||||||| ||||||||| |||||||||||||    
8362536 ttgggctccagtagcaaggaactccttctaaggat----cggggaataccgggttcaattcccagtggaaacaacgtttggccagtccgcatgcctctac 8362631  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||||||||| ||||||||  ||||||| |||| || ||||| ||||||||    
8362632 gcatgagccaaattagtcgtccacctttagtggatccgaaaccggtgcgaa 8362682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 43 - 159
Target Start/End: Complemental strand, 45402465 - 45402349
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||| ||||||||||| | |  |||||||||  | |||| ||||||||||||||||||||||||| ||||||||| |||||||| |||||||||    
45402465 ccggggaatatcgggttcgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgg 45402366  T
143 aaactggtgcgaaagcc 159  Q
    |||||| |||| |||||    
45402365 aaactgatgcgcaagcc 45402349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 26 - 158
Target Start/End: Complemental strand, 15795625 - 15795493
Alignment:
26 ctccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    ||||||||||| ||||||| ||||||||||| |||||||| ||| ||||||||||| |||| ||||||||||||||||||||| ||||   |||||||||    
15795625 ctccttccaaggacgtacccggggaataccgagttcgattccca-ggggaacaacgcttggtcagtgcgcatgcctctacgcacgagctgaattagtcgc 15795527  T
125 tcacctttggtgggtcggaaactggtgcgaaagc 158  Q
     ||||  |||||||||| |||| ||||| |||||    
15795526 ccaccaatggtgggtcgaaaaccggtgcaaaagc 15795493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 140
Target Start/End: Original strand, 40944837 - 40944972
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||||||| | ||||||||||| ||||| || | |||||||| |||||||| ||| ||||||||||  ||  |||||  |||||||||||    
40944837 ttgggctccggtggcaagaagctccttccaaggacgtatccagagaataccgagttcgattcccagggggaacaacacttaaccagtatgcatgcctcta 40944936  T
104 cgcatgagccagattagtcgctcacctttggtgggtc 140  Q
    |||||||| | ||||||||||||||||||||||||||    
40944937 cgcatgag-cggattagtcgctcacctttggtgggtc 40944972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 49082774 - 49082906
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||| ||| ||||||| ||| ||||| ||||||||||||| |||||||| ||| || |||||||| || ||||||||||||||     
49082774 ttgtttgggctccagtggcagggagctccttctaaggacgtatccggggaataccgagttcgattcccagggagaacaacgcttagccagtgcgcatgca 49082873  T
100 tctacgcatgagccagattagtcgctcaccttt 132  Q
    ||||| || ||  |||||||||| | |||||||    
49082874 tctacacacgaatcagattagtcacccaccttt 49082906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 47 - 158
Target Start/End: Original strand, 23511564 - 23511675
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| |||||||||||  |||||||| ||||| ||| |||||||||||||||||||||||||| | ||||| |||  |||||||| ||||||| ||||    
23511564 ggaatatcgggttcgattcacaaggggagcaacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaac 23511663  T
147 tggtgcgaaagc 158  Q
     |||||||||||    
23511664 cggtgcgaaagc 23511675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 97
Target Start/End: Complemental strand, 37092658 - 37092565
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    |||||||||||||||||||| || |||||||| ||||||| | |||||| ||| || |||||||||||||||||||| ||||||||||||||||    
37092658 ttgggctccagtggcaaggagcttcttccaaggacgtacccgtggaatatcggattagatttccaaggggaacaacgtttggccagtgcgcatg 37092565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 90 - 159
Target Start/End: Original strand, 44064584 - 44064653
Alignment:
90 tgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||| ||||||    
44064584 tgcgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagcc 44064653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 45450597 - 45450447
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||| | ||| |||||||| |||| |||  |||||| ||||| |||||||| ||||||||| | ||| ||||||||||||||||||    
45450597 ttgggctccagtggcaag-agctcattccaaga-cgtatccgtagaatactgggtttgatttcca-ggggaacaatgcttgaccagtgcgcatgcctcta 45450501  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| ||| ||||||||||  |||||||| || || |||||| ||||||||||    
45450500 cgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaaag 45450447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 86 - 159
Target Start/End: Complemental strand, 49021274 - 49021201
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||||||||||| |||||||||  |||| |||||||||||||||| ||||||||||||    
49021274 ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 49021201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 928550 - 928709
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| ||||| | ||||||||| ||| ||||||| |||||||  ||||||||| | |||||||  || ||||||||||  ||| ||||||||||||||    
928550 ttgtttaggctcaactggcaaggagctcattccaaggacgtacctagggaataccagattcgattctcagggggaacaacacttgaccagtgcgcatgcc 928649  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||||| ||||| ||||||||   ||||||||||| |||| |||  ||||||||||||    
928650 gctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcggtgcgaaagcc 928709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 5 - 123
Target Start/End: Original strand, 3755524 - 3755643
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||||||||| || ||| || |||| ||||| |||||||||||||  ||||||| ||| | ||||||||| ||| |||||||||||| |||||    
3755524 ttggactccagtggcaaagagctcttttcaaggacgtatccggggaataccgacttcgattcccaggaggaacaacgtttgaccagtgcgcatgtctcta 3755623  T
104 cgcatgagccagattagtcg 123  Q
    |||||||||| |||||||||    
3755624 cgcatgagccggattagtcg 3755643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 2 - 96
Target Start/End: Complemental strand, 7613082 - 7612987
Alignment:
2 tgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcat 96  Q
    ||||||| || |||||||||||| ||||||||||| ||||||  |||||||||||||||||||| ||| ||||||||||| ||||| |||||||||    
7613082 tgtttggacttcagtggcaaggagctccttccaaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttggctagtgcgcat 7612987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 45 - 152
Target Start/End: Original strand, 33688946 - 33689053
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||| ||||||| ||| | |||||||| |||  |||||||||||||||||||||||||||||||||| ||||||   |||| ||||||||| ||||    
33688946 ggggaatatcgggttcaattcctaaggggaataacacttggccagtgcgcatgcctctacgcatgagccagtttagtcatccaccattggtgggttggaa 33689045  T
145 actggtgc 152  Q
    || |||||    
33689046 accggtgc 33689053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 55 - 152
Target Start/End: Complemental strand, 50405705 - 50405608
Alignment:
55 gggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||||||||| | | ||| ||||||| ||| |||||||||||||||||||||| ||| | |||||||||| |||| |||||||||||||||| |||||    
50405705 gggttcgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgc 50405608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 35923780 - 35923628
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||||||| || ||| ||||||| ||||||| || ||||||| |||||||||   | ||||||||||| ||||||||||||||||||    
35923780 ttgtttgggctctagtggcaatgagctcattccaaggacgtacctggagaataccaggttcgattcatagggggaacaacgtttggccagtgcgcatgcc 35923681  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    |||| ||| ||| |  ||||||||  || ||||| ||| ||| |||| |||||    
35923680 tctaagcacgagtcgaattagtcgtccatctttgatggatcgaaaaccggtgc 35923628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 21 - 144
Target Start/End: Complemental strand, 52364937 - 52364813
Alignment:
21 aggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatta 119  Q
    |||| ||||||||||| ||||||| ||||||||||| |||||||| |||   ||||||||| ||| |||||||||||||||||||||| ||||  |||||    
52364937 aggagctccttccaaggacgtacccggggaataccgagttcgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggatta 52364838  T
120 gtcgctcacctttggtgggtcggaa 144  Q
     |||   ||||||| ||||||||||    
52364837 atcgtctacctttgatgggtcggaa 52364813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 43 - 159
Target Start/End: Original strand, 54237441 - 54237557
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    ||||| |||| |||| ||||||| || || |||||||  |||| ||||||||||| ||||||||||||||| ||| |||||  |||| || |||||||||    
54237441 ccgggaaatatcggggtcgattttcagggagaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcgg 54237540  T
143 aaactggtgcgaaagcc 159  Q
    |||| ||||||||||||    
54237541 aaaccggtgcgaaagcc 54237557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 46530027 - 46529924
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||||| |||| ||||||| ||||||||||||||||||||  ||  || ||||| | || ||||||| |||||||    
46530027 ttgtttgggctccagtggcaaggagctcctttcaaggacgtacctggggaataccgggttcgattctcagaggaaacaatgcttcgccagtgtgcatgcc 46529928  T
100 tcta 103  Q
    ||||    
46529927 tcta 46529924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 88 - 158
Target Start/End: Original strand, 10043720 - 10043790
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| |||||||||||||| ||| ||||||| ||||||||| |||||||||||||||| |||||||||||    
10043720 agtgcacatgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaagc 10043790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 43 - 152
Target Start/End: Complemental strand, 40660441 - 40660332
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    ||||| |||||||| ||||||| | | | ||||||||  |||| |||||||||||||||||||||||| || ||||| ||  |||||||||||||||||     
40660441 ccgggaaataccggattcgattcctaggaggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcga 40660342  T
143 aaactggtgc 152  Q
    |||| |||||    
40660341 aaaccggtgc 40660332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 41219547 - 41219700
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    ||||||||| || |||| || ||||||| ||| |||||   |||||||||  ||||||||  || | ||||||||| |||||||||||| |||||||| |    
41219547 ttgggctcccgttgcaatgagctccttctaaggacgtatacgggaataccaagttcgattctcaggaggaacaacgtttggccagtgcgtatgcctctgc 41219646  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||| ||||  ||||| || |||||||||||||| ||| ||||  ||||||||||    
41219647 gcacgagctggattaatcactcacctttggtggatcgtaaaccagtgcgaaagc 41219700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 86 - 159
Target Start/End: Complemental strand, 43330803 - 43330730
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||||| ||||| |||||||||| |||||||||||||||  |||| ||| ||||||||    
43330803 ccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggtacgaaagcc 43330730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 82 - 158
Target Start/End: Original strand, 2668093 - 2668169
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||| ||||  |||||||||||||||||| |||||| |||||   ||||||||||    
2668093 ttggccagtgcgcatgcctctacgcaagagctggattagtcgctcacctttagtgggttggaaatcagtgcgaaagc 2668169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 26 - 157
Target Start/End: Original strand, 19146936 - 19147068
Alignment:
26 ctccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    |||||||||| ||||||  ||||||| | | | |||||||| || | ||||||||| |||||||||| | || |||||| ||| ||||  |||||||||     
19146936 ctccttccaataacgtattcggggaagatcagattcgattttcaggaggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgt 19147035  T
125 tcacctttggtgggtcggaaactggtgcgaaag 157  Q
     ||||||||||||||||||||| ||||||||||    
19147036 ccacctttggtgggtcggaaaccggtgcgaaag 19147068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 70 - 141
Target Start/End: Original strand, 7648760 - 7648831
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcg 141  Q
    ||||||||||| ||| ||||||||||| |||||||||| ||||| |||||||||| |||||||| |||||||    
7648760 ggggaacaacgtttgaccagtgcgcatacctctacgcacgagccggattagtcgcccacctttgttgggtcg 7648831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 36043730 - 36043672
Alignment:
101 ctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||| ||||| |||||||||| ||||||||||||||||||||| ||||||||||||    
36043730 ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagcc 36043672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 68 - 157
Target Start/End: Original strand, 13367442 - 13367531
Alignment:
68 aaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||| |||| ||||| |||||||| |||||||||||| |||||||| |  ||| ||| ||||| |||||| ||||||||||    
13367442 aaggggaacaacgcttggtcagtgtgcatgcctttacgcatgagccggattagtcacctaccgttgttgggtaggaaaccggtgcgaaag 13367531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 19873344 - 19873481
Alignment:
26 ctccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac------gcatgagccagatta 119  Q
    ||||||||||  |||||| |||||||||| |||| |||| ||| | ||||||| | |||||||||||||||||||||||      ||| ||||| |||||    
19873344 ctccttccaatgacgtac-ggggaataccaggtttgattccca-gaggaacaatgcttggccagtgcgcatgcctctacctctacgcacgagccggatta 19873441  T
120 gtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||  || |||| ||||||||||||||||||| ||||||    
19873442 gtcgtccatcttttgtgggtcggaaactggtgcaaaagcc 19873481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 28242236 - 28242352
Alignment:
9 gctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    ||||| |||| || || ||||||||||  ||||| |||| |||||||||||| |||| ||| | ||||||| | ||||||||||| |||||||||| |||    
28242236 gctccggtggtaaagagctccttccaatgacgtatccggagaataccgggttagattgccaggaggaacaatgtttggccagtgcacatgcctctatgca 28242335  T
108 tgagccagattagtcgc 124  Q
    |||| | ||||||||||    
28242336 tgaggcggattagtcgc 28242352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 56 - 155
Target Start/End: Original strand, 4638160 - 4638259
Alignment:
56 ggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    ||||||||| ||| | | ||||||| ||| ||||||||||| |||||||||| ||||| ||||||| || |||||||  |||||||||||| | ||||||    
4638160 ggttcgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa 4638259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 55 - 158
Target Start/End: Complemental strand, 26590368 - 26590265
Alignment:
55 gggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    ||||||||||  || ||||||||||| |||| ||||| |||||||||||| || |||| |||||| ||| ||   |||||||| |||||||| |||||||    
26590368 gggttcgattctcagggggaacaacgcttggtcagtgtgcatgcctctacacacgagctagattaatcgatcgtatttggtggatcggaaaccggtgcga 26590269  T
155 aagc 158  Q
    ||||    
26590268 aagc 26590265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 33560810 - 33560889
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaac 79  Q
    ||||||||||| |||||||||||| ||||||||||| | ||||| ||||||||||||||| |||  ||| ||||||||||    
33560810 ttgtttgggcttcagtggcaaggagctccttccaaggatgtacctggggaataccgggtttgatccccagggggaacaac 33560889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 103
Target Start/End: Complemental strand, 13167591 - 13167497
Alignment:
14 agtggcaaggaactccttccaagaacgtacc-----ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||| ||||||||||| ||||||      |||||||| ||||||||||| ||||  ||||||||| ||||||||||| ||||||||||    
13167591 agtggcaaggagctccttccaaggacgtacgtatctggggaatatcgggttcgattcccaaaaggaacaacgcttggccagtgcacatgcctcta 13167497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 43 - 157
Target Start/End: Original strand, 22909777 - 22909890
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||| ||||| |||||||||||  || | ||||||||| | ||| ||||||||| | ||||||||||||||  ||||||||  |||||||| ||||||||    
22909777 ccggagaatatcgggttcgattctca-gaggaacaacgctaggctagtgcgcatacttctacgcatgagccgaattagtcgtgcacctttgatgggtcgg 22909875  T
143 aaactggtgcgaaag 157  Q
    ||||  |||||||||    
22909876 aaaccagtgcgaaag 22909890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 96 - 158
Target Start/End: Original strand, 47164152 - 47164214
Alignment:
96 tgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| ||||| ||||||||||||| ||||||||| |||||||| |||| ||||||    
47164152 tgcctctacgcacgagccggattagtcgctcatctttggtggatcggaaaccggtgtgaaagc 47164214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 52168727 - 52168581
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgggg-aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||  |||| |||||||| ||||||||| ||| || |||| ||  |||| | ||||||||||||| || |||||| | ||||||| ||||||||||    
52168727 ttgtttgcactccggtggcaagaaactccttctaaggacatacccggataatatcaggttcgatttccagggtgaacaatgtttggccaatgcgcatgcc 52168628  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
     | || |||||||| ||||||||| ||||  ||| ||||||| ||||    
52168627 ccaacacatgagccggattagtcgttcacaattgatgggtcgaaaac 52168581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 82 - 159
Target Start/End: Complemental strand, 34374517 - 34374440
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||||||||||||| |||||| || | |||||||||| |  |||||||||||||||||| |||| |||||||    
34374517 ttggtcagtgcgcatgcctcaacgcataagtcggattagtcgcccttctttggtgggtcggaaaccggtgtgaaagcc 34374440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 35998720 - 35998569
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||       ||||||  ||||||| || |||||||||||| |||||| | ||| ||||||| |||  |||||| ||||||    
35998720 ttgtttgggctccagtggcaag-------ttccaaagacgtacccggagaataccgggtttgatttcga-gggaaacaacgcttgatcagtgcacatgcc 35998629  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||   ||||| |||  ||||||| ||||||| ||||| ||||||||||||    
35998628 tctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcgaaagcc 35998569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 157
Target Start/End: Complemental strand, 20948169 - 20948061
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactg 148  Q
    ||||| |||||||||| |||| |||||||||  ||| |||||| ||||||||||| ||| || | |||||||||| ||||| ||||| | ||| |||  |    
20948169 aatactgggttcgattaccaaagggaacaacatttgaccagtgtgcatgcctctatgcacgaacgagattagtcgttcaccgttggtagatcgaaaatcg 20948070  T
149 gtgcgaaag 157  Q
    |||||||||    
20948069 gtgcgaaag 20948061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 30735102 - 30735022
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacg 80  Q
    |||||||||||| ||||||||||| ||| ||||||| ||| || |||||||||||| ||||||||  || |||||||||||    
30735102 ttgtttgggctctagtggcaaggagctcattccaaggacgcactcggggaataccgagttcgattctcagggggaacaacg 30735022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 29 - 156
Target Start/End: Complemental strand, 34662448 - 34662320
Alignment:
29 cttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctca 127  Q
    |||||||| ||||||  |||||||| |||||||||||| || | |||| |||| |||| |||| |||||| ||||| |||||||||  ||||||||  ||    
34662448 cttccaaggacgtacttggggaatatcgggttcgattttcaggaggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcgtcca 34662349  T
128 cctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||| |||| | |||||| | |||||||    
34662348 cctttagtggattggaaaccgatgcgaaa 34662320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 45 - 156
Target Start/End: Complemental strand, 2029379 - 2029268
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||| ||  |||||||| || | | ||||||| ||||  ||| |||||||||||||||||||||  |||||||||| |||| ||| ||||||| ||    
2029379 ggggaataacgaattcgattttcaggagaaacaacgcttggttagtacgcatgcctctacgcatgagctggattagtcgcccaccattgatgggtcgcaa 2029280  T
145 actggtgcgaaa 156  Q
    ||  ||||||||    
2029279 accagtgcgaaa 2029268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 5 - 123
Target Start/End: Complemental strand, 47303642 - 47303523
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||| ||||| ||  ||||||| ||||| ||||  |||| |||||| |||| ||| | ||||||||  |||| |||||| ||||||||||    
47303642 ttgggctccggtggtaaggagctttttccaaggacgtatccggaaaatatcgggtttgattcccaggaggaacaacacttggtcagtgcacatgcctcta 47303543  T
104 cgcatgagccagattagtcg 123  Q
    | |||||||| |||||||||    
47303542 cacatgagccggattagtcg 47303523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 79
Target Start/End: Complemental strand, 52011113 - 52011046
Alignment:
13 cagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaac 79  Q
    |||||||||||||||||||||||| |||||| |  |||||| ||||||||||| ||| ||||||||||    
52011113 cagtggcaaggaactccttccaaggacgtactccaggaatatcgggttcgattcccagggggaacaac 52011046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 10043100 - 10043170
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaag 70  Q
    |||||||||||||| |||||| || |||||| |||| ||||| |||||||||| ||||||||||| |||||    
10043100 ttgtttgggctccactggcaatgagctcctttcaaggacgtatccggggaatatcgggttcgattcccaag 10043170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 22405700 - 22405554
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||| ||||  ||||| ||| | |||||||| ||| |||  || | ||||||||| ||  ||| |||| |||||    
22405700 ttgtttgggctccagtggcaaggagctcctaccaatgacgtatccgtgaaataccggattctattctcaggaggaacaacgcttaaccaatgcgaatgcc 22405601  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    | || ||| ||||| ||||| |||  || |||||||| |||||||||    
22405600 tttatgcacgagccggattaatcgtccatctttggtgcgtcggaaac 22405554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 46 - 156
Target Start/End: Complemental strand, 25515858 - 25515749
Alignment:
46 gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    ||||||||||||||| ||| | | ||||||||| | ||||| ||||  ||||| |||||| |||||   ||||||||||||||| || |||| |||||||    
25515858 gggaataccgggttctattacta-ggggaacaatgtttggctagtgtacatgcttctacgtatgagttggattagtcgctcaccattagtggatcggaaa 25515760  T
146 ctggtgcgaaa 156  Q
    ||| |||||||    
25515759 ctgatgcgaaa 25515749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 94 - 159
Target Start/End: Complemental strand, 29195382 - 29195317
Alignment:
94 catgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| ||||| ||||||||||||  ||||||| |||||| |||||| ||| ||||||||    
29195382 catgcctctacacatgaaccagattagtcgtccacctttagtgggttggaaaccggtacgaaagcc 29195317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 93 - 158
Target Start/End: Complemental strand, 50753405 - 50753340
Alignment:
93 gcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||| ||| | ||||||||| ||| | |||||||||||||||| ||||| |||||    
50753405 gcatgcctctacgcacgagtcggattagtcgttcatcattggtgggtcggaaaccggtgcaaaagc 50753340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 6286075 - 6286187
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||  |||| |||||| ||||||||||| | ||| | |||||||||| | |||||||||||   |||||||| | | | |||||||||||||    
6286075 ttgtttgggctttagtgacaaggagctccttccaaggaagtatcaggggaataccagattcgatttccagaaggaacaac-acttgacagtgcgcatgcc 6286173  T
100 tctacgcatgagcc 113  Q
    ||||| ||| ||||    
6286174 tctacacataagcc 6286187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 13 - 145
Target Start/End: Complemental strand, 24146473 - 24146340
Alignment:
13 cagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    ||||| |||||| ||||||||||| || || | |||||||| |||||| ||||  |||||  ||||||  |||| || | ||||||||||||  ||||||    
24146473 cagtgacaaggagctccttccaaggacatatctggggaatatcgggtttgattctcaaggataacaacacttggtcaatacgcatgcctctagacatgag 24146374  T
112 ccagattagtcgctcacctttggtgggtcggaaa 145  Q
    ||  ||||||||  |||| ||| |||||||||||    
24146373 ccgaattagtcgtccaccattgatgggtcggaaa 24146340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 89 - 146
Target Start/End: Original strand, 32522018 - 32522075
Alignment:
89 gtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||  | |||||||||| |||||||||||  |||||||| ||||||||||||    
32522018 gtgcgcatgtatttacgcatgagtcagattagtcgtccacctttgatgggtcggaaac 32522075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 106 - 146
Target Start/End: Complemental strand, 8683291 - 8683251
Alignment:
106 catgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||| |||||||||  |||||||||||||||||||||    
8683291 catgagccggattagtcgtccacctttggtgggtcggaaac 8683251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 5 - 92
Target Start/End: Complemental strand, 11025524 - 11025438
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgc 92  Q
    |||||||||||||| ||||| | ||||||||| ||||| | |||||||||| ||||||| |||| ||||| |||||  |||||||||||    
11025524 ttgggctccagtggtaaggagc-ccttccaaggacgtatctggggaataccaggttcga-ttccgagggggacaacacttggccagtgc 11025438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 100; Significance: 3e-49; HSPs: 96)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 53599015 - 53599174
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||    
53599015 ttgtttgggctccattggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccaggaggaacaacgtttggccagtgcgcatgcc 53599114  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| ||||| ||| |||||||| |||| |||||||| ||||||||||||    
53599115 tctacgcatgagccggattaatcgttcacctttagtggatcggaaaccggtgcgaaagcc 53599174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 24166409 - 24166563
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||| |||||||||| |||||||||| ||||||| ||||||| ||||||||||||||||||||||    
24166409 ttgggctccagtggcaaggagctccttccaaggacgtactcggggaatactgggttcgattcccaagggaaacaacgtttggccagtgcgcatgcctcta 24166508  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||||||||||| | |||||||| ||| |||||||| |||||||||||    
24166509 cgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaaagc 24166563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 38165982 - 38166140
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| ||||||||||| ||||| ||||||||||| ||||| |||| ||| ||||||||||| |||||||||||||||| |    
38165982 ttgtttgggctccactggcaaggagctccttccaaggacgtatccggggaatactgggttggattcccagggggaacaacgcttggccagtgcgcatggc 38166081  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| |||||||||| ||||||||||||||||||||| |||||||||||    
38166082 tctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 38166140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 47078417 - 47078571
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||| |||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| ||| ||||||||||| ||||||||||| ||||||||||    
47078417 ttgggttccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatgcctcta 47078516  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||||| ||||||||||||||| ||||||||||||||||  ||||||||||    
47078517 cgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcgaaagc 47078571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 55920993 - 55921147
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||| ||| |||||||||||||||||||| ||| ||||||||||  |||| |||||||||||||||||    
55920993 ttgggctccagtggcaaggagctccttccaaggacgcacccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcctcta 55921092  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    || ||||||| ||||| |||||||||||||||||||||||||| |||||||||||    
55921093 cgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc 55921147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 29895746 - 29895899
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||||||    
29895746 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 29895845  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| |||||||||  |||| ||||||| |||||||| ||||||||||    
29895846 cgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 52950037 - 52950195
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||||||||||| ||||||| |||||||| ||||||||||| ||| ||||||||||| |||||||||||||||| |    
52950037 ttgtttgggctctagtggcaaggagctccttccaaggacgtacctggggaatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgac 52950136  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| ||||| ||||||||||||  ||||||||||||||||||||| | |||||||||    
52950137 tctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaaagc 52950195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 5473004 - 5472846
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||| || |||| ||||| |||||||||||| |||| ||||  || ||| ||||||| ||||||||||||||||||    
5473004 ttgtttgggctccagtggcaaggagctcatttcaaggacgtatccggggaataccaggtttgattctcaggggaaacaacgcttggccagtgcgcatgcc 5472905  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| |||||||||| |||||||||||||||| ||||||||||||||||    
5472904 tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaactggtgcgaaagc 5472846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 2559262 - 2559419
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||||||||||| ||||||| |||||||||||| ||||||||| | | ||||||||| ||||||||||||||||||    
2559262 ttgtttgggctccagtggcaacgagctccttccaaggacgtacctggggaataccggattcgatttctaggaggaacaacgcttggccagtgcgcatgcc 2559361  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||  |||| ||||| |||  ||||||||||||||||||||| ||||||||||    
2559362 tctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcgaaag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 13073493 - 13073649
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| |||||||| || ||||||||||| ||||||| || |||||||| |||||||| ||| ||||||||| | ||||||||||||||| ||    
13073493 ttgtttgggctctagtggcaatgagctccttccaaggacgtacctggagaataccgagttcgattcccatggggaacaatgtttggccagtgcgcatacc 13073592  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||||| |||||||||||| | |||||||||||||||||||| |||||||||    
13073593 tctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 29 - 158
Target Start/End: Complemental strand, 3159597 - 3159467
Alignment:
29 cttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctca 127  Q
    |||||||| ||||| |||| ||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||    
3159597 cttccaaggacgtatccggagaataccgggttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctca 3159498  T
128 cctttggtgggtcggaaactggtgcgaaagc 158  Q
    || |||||||||||||||| ||||| |||||    
3159497 ccattggtgggtcggaaaccggtgcaaaagc 3159467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 14123971 - 14124128
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||| | ||||||||||||||||||  | |||||||| ||||||||| ||| ||||||||||  ||||||||||||||||||    
14123971 ttgtttgggctccaatggcaagaagctccttccaagaacgtacttgaggaataccaggttcgattcccagggggaacaacatttggccagtgcgcatgcc 14124070  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| || ||||| ||||||||||||||| ||||||||| |||||| ||||||||||    
14124071 tctacacacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaag 14124128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 5 - 123
Target Start/End: Original strand, 1446785 - 1446904
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||||||    
1446785 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctcta 1446884  T
104 cgcatgagccagattagtcg 123  Q
    |||||||||| |||||||||    
1446885 cgcatgagccggattagtcg 1446904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 27 - 157
Target Start/End: Complemental strand, 7246776 - 7246645
Alignment:
27 tccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgct 125  Q
    |||||||||| ||||||| ||||||||| |||||||||| | |  |||||||||| |||||||||||||||||||||||||||||||| ||||||||||     
7246776 tccttccaaggacgtacccggggaatactgggttcgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcc 7246677  T
126 cacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||||||||| ||||||||||    
7246676 cacctttggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 27248387 - 27248538
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||| || ||||||||||| ||||| |||||||||||||||||||| | ||| | ||||||||| ||||||||  ||||||||||||    
27248387 ttgggctccagtggcaacgagctccttccaaggacgtatccggggaataccgggttcgagtcccaggaggaacaacgcttggccag--cgcatgcctcta 27248484  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| |||||||||||||||| |||||||||| |||| |||||||||| |||||    
27248485 cgcaggagccagattagtcgcccacctttggtaggtcagaaactggtgtgaaag 27248538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 1940930 - 1940774
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||||||||||| ||||||| ||||| || ||||||||||| ||| ||||||||||| ||||   |||||||||||    
1940930 ttgtttgggctctagtggcaaggagctccttccaaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcc 1940834  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| |||||||||||||||| |||| ||||||| ||||    
1940833 tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgatagcc 1940774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 38168227 - 38168370
Alignment:
16 tggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    ||||||||| ||||||||||| ||||||| |||||||||| ||||||||| | ||| ||||||||| ||||||||||| ||||||||||||||||||||     
38168227 tggcaaggagctccttccaaggacgtacccggggaataccaggttcgattcctaagaggaacaacgcttggccagtgc-catgcctctacgcatgagccg 38168325  T
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||| |||||||| |||||| |||||| ||||||||||||    
38168326 gattagtcgttcacctttagtgggttggaaaccggtgcgaaagcc 38168370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 42722724 - 42722576
Alignment:
10 ctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    |||||||||  |||| ||||||||||| ||||||| ||||| |||||||||| ||| ||| | ||||||||| |||||||||||||||||||||||||||    
42722724 ctccagtggttaggagctccttccaaggacgtacccgggaaataccgggttcaattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcat 42722625  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| ||||||||| |||||||| |||||||| |||| ||||||||||    
42722624 gagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 8888977 - 8889128
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| || |||||||| ||||||| ||| ||||| |||||||||||||||||||||| | | ||||||||||  |||| ||||||||||| |    
8888977 ttgtttgggctctagcggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcctagggggaacaacacttgggcagtgcgcatggc 8889076  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtg 151  Q
    |||||||||||||| |||||||||  ||||||||||||||||||||| ||||    
8889077 tctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 6779166 - 6779324
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| || |||||||| ||||||| || ||||||||||||||||| ||| ||||||||||   |||||||||||||||||    
6779166 ttgtttgggctccagtggcaaggagcttcttccaaggacgtacctggagaataccgggttcgattcccagggggaacaacacctggccagtgcgcatgcc 6779265  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||||||||| |||||||||  |||||||||||  |||||| | | |||||||||    
6779266 tctatgcatgagccggattagtcgtccacctttggtgaatcggaacccgatgcgaaagc 6779324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 15732604 - 15732446
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||| || | |||||||| ||||| |||| |||||||||||||||||   | ||||||||||  ||||||||||| ||||||    
15732604 ttgtttgggctccagtggcaagaaaattcttccaaggacgtatccggagaataccgggttcgattcatatggggaacaacacttggccagtgcacatgcc 15732505  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| | || |||||||||||||| ||||||||| |||||||| |||||||||||    
15732504 tctacgcacgggctagattagtcgctcatctttggtggatcggaaaccggtgcgaaagc 15732446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 33647680 - 33647832
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| |||||| |||| ||||| | |||||||||||||||||||||||| || |||||||| ||| ||||||| ||| ||||||    
33647680 ttgggctctagtggcaaggagctcctttcaaggacgtatctggggaataccgggttcgatttccagggagaacaacgcttgaccagtgcacattcctcta 33647779  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||| || |||||||||||| ||| ||||||||| |||||||| |||||||||    
33647780 cgcacgaaccagattagtcgttcatctttggtggatcggaaaccggtgcgaaa 33647832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 40781017 - 40780861
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||| ||||||||||||||||||| || |||  ||| |||||  |||  |||| |||||||||||  |||||||||||||| |||| |||||||||||||    
40781017 ttgtctgggctccagtggcaaggagcttcttttaaggacgtattcggaaaatatcgggttcgattctcaaggggaacaacgcttggtcagtgcgcatgcc 40780918  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||||||| |||||||||  ||||||||||||||||||||| |||||||||    
40780917 tctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 40780861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 16 - 159
Target Start/End: Complemental strand, 49260806 - 49260662
Alignment:
16 tggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    ||||||||||||||||||||| | ||| ||||||||||| |  ||| ||| ||||||||||||||| |||||||||||||||||||||||||| |||||     
49260806 tggcaaggaactccttccaaggatgtatccggggaatactgaattcaattcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccg 49260707  T
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||  ||||||||||||||||||||  ||||| ||||||    
49260706 gattagtcgaccacctttggtgggtcggaaatcggtgcaaaagcc 49260662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 295688 - 295534
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||||| ||||| ||| ||||| |||||||||||| | ||||||| ||| | ||||||||| ||||||||||||||||||    
295688 ttgtttgggctccagtggcaaggaacaccttctaaggacgtatccggggaataccagattcgattccca-gaggaacaacgtttggccagtgcgcatgcc 295590  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||||||| || ||||||||||||  |||| |||||||||  ||||| ||||||||    
295589 tctacgcacgaaccagattagtcgtccaccgttggtgggtttgaaaccggtgcgaa 295534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 27 - 157
Target Start/End: Original strand, 43468328 - 43468459
Alignment:
27 tccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgct 125  Q
    |||||||||||||||||| |||||||||||||||||||| ||| ||||||||||| ||||||||||| |||  ||||||||||||||| ||||||||||     
43468328 tccttccaagaacgtacccggggaataccgggttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcc 43468427  T
126 cacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||  |||||||||||| || ||||||||||    
43468428 caccagtggtgggtcggagaccggtgcgaaag 43468459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 38075388 - 38075546
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||| ||||||||  |||||||||| |||||  ||| |||||||||||||||||  || ||| ||||||| ||||||||||||||||||    
38075388 ttgtttgggctccagcggcaaggagttccttccaaggacgtattcggagaataccgggttcgattctcaggggaaacaacgcttggccagtgcgcatgcc 38075487  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||  |||| | |  ||||||||||||||||||||| | |||||||||    
38075488 tctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaagc 38075546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 40272487 - 40272341
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| |||| ||||| ||| ||||||  | ||| |||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||    
40272487 ttgtttgggctccggtggtaaggagctctttccaatgatgtatccggggaatatcgggttcgatttccatggggaacaacgcttggccagtgcgcatgcc 40272388  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||| || | |||| |||| ||||| ||||||||||||||||    
40272387 tctacgcataagtcggatttgtcgttcaccattggtgggtcggaaac 40272341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 3574598 - 3574445
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| |||||||  |||||||||| |||| ||| ||| || |||||||  ||||||||||||||||||||||    
3574598 ttgggctccagtggcaaggagctccttccaaggacgtacctagggaataccgagttcaattcccagggagaacaacacttggccagtgcgcatgcctcta 3574499  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||| | ||||||||||||||||| |||  ||||||||| |||| |||||||    
3574498 cgcacgagtcggattagtcgctcaccttaggt--gtcggaaaccggtgagaaagcc 3574445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 36262913 - 36262764
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    |||||||||||||| | ||||||||||| ||||||| || ||||||||||||||||| |||  |||||||||| ||||||||||| ||||||||||||||    
36262913 gctccagtggcaagaagctccttccaaggacgtacccggagaataccgggttcgattccca--gggaacaacgcttggccagtgcacatgcctctacgca 36262816  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||| | |||||||||| ||||||||||||||| |||||   ||||||||||    
36262815 cgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagcc 36262764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 55 - 158
Target Start/End: Original strand, 16450310 - 16450413
Alignment:
55 gggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcga 154  Q
    |||||||||| ||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||  |||||||||| |||||||||| |||||||    
16450310 gggttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcga 16450409  T
155 aagc 158  Q
    ||||    
16450410 aagc 16450413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 10 - 159
Target Start/End: Original strand, 20128273 - 20128423
Alignment:
10 ctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    |||||| ||||||||  |||||||||| ||||| ||||||||||| ||||||||||  || ||||||||| | ||||||||||||||||||| ||||||     
20128273 ctccagcggcaaggagttccttccaaggacgtatccggggaatactgggttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcac 20128372  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||||||||  |||| |||||||||| ||||| ||||||||||||    
20128373 gagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaagcc 20128423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 10 - 159
Target Start/End: Complemental strand, 36145362 - 36145212
Alignment:
10 ctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    |||| |||||||||| ||| ||||||| ||||||| |||||||||||||||||||| ||| ||| ||||||| |||  |||||||||||||||||| |||    
36145362 ctccggtggcaaggagctcattccaaggacgtacccggggaataccgggttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacat 36145263  T
109 gagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||||  |||||||| ||  |||||||| ||||||||||||    
36145262 gagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaaagcc 36145212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 41339551 - 41339417
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||||||||||| ||||||| || ||||||||||||||| | ||||||||||||||| |||||||||| | |||||    
41339551 ttgtttgggctctagtggcaaggagctccttccaaggacgtacccggagaataccgggttcgactcccaaggggaacaacgcttggccagtgtgtatgcc 41339452  T
100 tctacgcatgagccagattagtcgctcacctttgg 134  Q
    |||||||| ||| | |||||||||| |||| ||||    
41339451 tctacgcacgagacggattagtcgcccaccattgg 41339417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 20532561 - 20532420
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||  ||| |||||||  | |||| || |||||||| |||||||||||| | ||||||||| ||||||||||||||||||||||    
20532561 ttggactccagtggcaaggtgctcattccaaggccatacccggagaataccgagttcgatttccaggaggaacaacgcttggccagtgcgcatgcctcta 20532462  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||||| ||| |||||| |||||||||||| |||||||    
20532461 cgcatgagccggataagtcgcccacctttggtggatcggaaa 20532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 5 - 156
Target Start/End: Complemental strand, 6032792 - 6032643
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| |||| || | || ||   | ||| ||||||| ||||||||||    
6032792 ttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcaattttcaggaggtac---gcttgaccagtgctcatgcctcta 6032696  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    || ||||||| |||||||||   |||||||||||||||||||| |||||||||    
6032695 cgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaa 6032643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 10540971 - 10541128
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| |||||| | |||||  || |||||| ||||||||   |||||| ||||||||||||||| ||| ||||||| |||||||||| |||||||    
10540971 ttgtttgggttccagtagtaaggagttcattccaaaaacgtacctaaggaatatcgggttcgatttccaggggaaacaacgcttggccagtgtgcatgcc 10541070  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||||||||| |||| |||||||| ||| |||||||| |||||||||||    
10541071 tctacgcacgagccagattaatcgc-cacctttgatggatcggaaaccggtgcgaaagc 10541128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 15840083 - 15839934
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||||||||||| ||||||||||| ||||||  |||||||||||||||||||| || ||  ||| |||| |||||||||||||||||||||||||    
15840083 ggctccagtggcaaggagctccttccaaggacgtacttggggaataccgggttcgatt-cctagaagaataacgtttggccagtgcgcatgcctctacgc 15839985  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| |||||||||| |  ||||| | ||| ||||||  |||||||||    
15839984 atgagccggattagtcgcccttctttgataggttggaaaccagtgcgaaag 15839934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 16645117 - 16645231
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    |||||||||||||||||||||| || |  |||||||| |||||||||| |||||||||||| |||||| | |||||||||| ||||| ||||||||||||    
16645117 cggggaataccgggttcgattttcaggaagaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcgga 16645216  T
144 aactggtgcgaaagc 158  Q
    ||| |||||||||||    
16645217 aaccggtgcgaaagc 16645231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 41163034 - 41162880
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||| |||||| ||||||||||| ||||| ||||| ||||||| ||||||||||||  |||||||||  ||||||||||  ||||| ||||    
41163034 ttgggctccagtgacaaggagctccttccaaggacgtatccgggaaataccgagttcgatttccagagggaacaacacttggccagtgtacatgcttcta 41162935  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
     |||||||||  ||||||||| |||||||| ||| ||||||| ||| ||||||||    
41162934 tgcatgagccgaattagtcgcccacctttgatggatcggaaattggagcgaaagc 41162880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 20421733 - 20421887
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| |||||||||||| |||||| |||  ||||| | ||||||||| || ||||||||||| ||||||||||  ||||||||||||||||||||||    
20421733 ttgggcttcagtggcaaggagctcctttcaaagacgtatctggggaatactgg-ttcgatttccagggggaacaacacttggccagtgcgcatgcctcta 20421831  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||| |||  || | ||| ||||||||||||  || ||||||||    
20421832 cgcatgagccagattaatcgtccatcattgatgggtcggaaaccagttcgaaagcc 20421887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 8064953 - 8064831
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||| ||||| ||| |||| || ||||||| ||||||||||| | |||||| |||||||||| |||||||||| |||  ||| |||||||||||||||    
8064953 ttgtttaggctctagtagcaaagagctccttctaagaacgtacctgagaatactgggttcgattcccaaggggaataacacttgaccagtgcgcatgcct 8064854  T
101 ctacgcatgagccagattagtcg 123  Q
    ||||||||||||| |||||||||    
8064853 ctacgcatgagccggattagtcg 8064831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 26 - 155
Target Start/End: Original strand, 21429281 - 21429411
Alignment:
26 ctccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    ||||||||||  ||||| ||| |||||| ||||||||||||  | ||||||||||| || ||||||||||||||||||||||| ||| |||| ||||||     
21429281 ctccttccaaagacgtatccgaggaatatcgggttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgt 21429380  T
125 tcacctttggtgggtcggaaactggtgcgaa 155  Q
     ||||||||||||||||||||| ||||||||    
21429381 ccacctttggtgggtcggaaaccggtgcgaa 21429411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 7000479 - 7000631
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||| | ||||||||||| |||||| |||||||||||| |||||||| ||| |  |||||||| ||||||| ||    ||||    
7000479 ttgtttgggctacagtggcaagaagctccttccaaggacgtactcggggaataccgagttcgattcccaggaagaacaacgcttggccaatg----tgcc 7000574  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||||||||||||||||| ||||||||| | | |||| ||||||||||    
7000575 tctacgcacgagccagattagtcgctca-ctttggtggattgaaaaccggtgcgaaag 7000631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 17080068 - 17080156
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||| ||| ||| |||| |||||||||||    
17080068 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc 17080156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 56 - 159
Target Start/End: Original strand, 4738629 - 4738732
Alignment:
56 ggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    ||||||||||||| | ||||||||| || ||||||||||||| ||||||||||||||   ||||||||  ||||||||||||||||||||| ||||||||    
4738629 ggttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaa 4738728  T
156 agcc 159  Q
    ||||    
4738729 agcc 4738732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 29588695 - 29588849
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||| ||||||  |||| || ||||| |||||||||||||| ||| ||| ||||| | ||||| ||||||||||||||||    
29588695 ttgggctccagtggcaaggagctcattccaaagacgtgcccgggaaataccgggttcgattcccaggggaaacaaagcttggctagtgcgcatgcctcta 29588794  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||||| |||||||    |||| |||||||||||||||  | |||||||||    
29588795 cgcacgagccggattagttatccaccattggtgggtcggaaatcgatgcgaaagc 29588849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 26480105 - 26479992
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| ||||||||||| ||||||  ||||||||||| ||||||||   |||||||| |||  ||||||||| ||||||||    
26480105 ttgtttgggctccactggcaaggagctccttccaagtacgtacatggggaataccgagttcgattcttaaggggaataacacttggccagtacgcatgcc 26480006  T
100 tctacgcatgagcc 113  Q
    ||||||||||||||    
26480005 tctacgcatgagcc 26479992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 43458572 - 43458725
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||| | ||| ||||||| |||||   ||||||||| || ||||||| ||| | |||| |||| ||||||||||||||||||||||    
43458572 ttgggctccagtggcaagaagctcattccaaggacgtatttggggaatactggattcgattcccaggaggaagaacgcttggccagtgcgcatgcctcta 43458671  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    || | ||||| |||||||||  |||||||| || ||||||||| | ||||||||    
43458672 cggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaag 43458725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 31588639 - 31588798
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgat--tggccagtgcgcatg 97  Q
    ||||||||||| ||||| |||||| ||| ||| ||| |||||  |||||||||  ||||| |||| |||  || ||||||| |  |||||||||||||||    
31588639 ttgtttgggcttcagtgtcaaggagctcgttctaaggacgtattcggggaatattgggtttgattcccagaggaaacaacgctcttggccagtgcgcatg 31588738  T
98 cctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
     ||||||||||||||| |||||||||||||| |||||||| |||||||| | ||||||||    
31588739 tctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 27 - 158
Target Start/End: Complemental strand, 48015203 - 48015071
Alignment:
27 tccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgct 125  Q
    |||||||||  ||||||| | |||||||||||||||||| |||  |||||||||| |||||||||||||| ||||||||||| ||||| ||||||| ||     
48015203 tccttccaaagacgtacccgaggaataccgggttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcc 48015104  T
126 cacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||  |||| ||| |||||||| |||||||||||    
48015103 caattttgatggatcggaaaccggtgcgaaagc 48015071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 82 - 157
Target Start/End: Original strand, 14567276 - 14567351
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||  ||||||||||    
14567276 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 14567351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 20354592 - 20354715
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||| || ||   ||||||| ||| |||||||| || |||||||| ||||| ||||||||||||    
20354592 ttgtttggactccagtggcaaggatctccttccaaggacgaactcgaaaaataccgagtttgatttccagggagaacaacgcttggctagtgcgcatgcc 20354691  T
100 tctacgcatgagccagattagtcg 123  Q
    |||||||||||| | |||||||||    
20354692 tctacgcatgagtcggattagtcg 20354715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 30317200 - 30317334
Alignment:
13 cagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    ||||||||||||  |||||  ||| |||||| ||||||||| | |||||||||  ||  |||||||||| ||||||||| || ||||||||||||| |||    
30317200 cagtggcaaggagttccttttaaggacgtactcggggaatatcaggttcgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgag 30317299  T
112 ccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||  ||||||||| |||||||||||||||||||||    
30317300 ccgaattagtcgcccacctttggtgggtcggaaac 30317334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 69 - 158
Target Start/End: Complemental strand, 47682469 - 47682380
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||| |||| ||||||||||| |||| ||||||||| ||||| | |||||||| ||||||||||||||||||||| |||||||||||    
47682469 aggggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 47682380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 26 - 153
Target Start/End: Original strand, 3507251 - 3507378
Alignment:
26 ctccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    |||||| |||||| ||| |||| ||||| ||||||||||| ||||||| ||||||| ||||| ||||||| ||||||||| || ||||| |||||||||     
3507251 ctcctttcaagaatgtatccggagaatatcgggttcgattcccaaggg-aacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgt 3507349  T
125 tcacctttggtgggtcggaaactggtgcg 153  Q
     |||||||||||| ||||||||| |||||    
3507350 ccacctttggtggatcggaaactagtgcg 3507378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 7741884 - 7742036
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| |||||| |||| |||||  || |||||| ||||||| | |  || ||| ||||||| ||||||||||| ||||||||||    
7741884 ttgggctctagtggcaaggagctcctttcaagtacgtattcgaggaatatcgggttccaatctcaggggtaacaacgcttggccagtgcacatgcctcta 7741983  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||| || ||||||||||||  || ||||||||  ||| ||||||||||||||    
7741984 cgcacgatccagattagtcgtccatctttggtgaatcgaaaactggtgcgaaa 7742036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 4736552 - 4736710
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||| ||||||||||||| || |||||| |||| | ||||| | |||||||||||||| |||  ||  || ||||||| ||||||| || |||||||    
4736552 ttgtttgagctccagtggcaatgagctcctttcaaggatgtacccgaggaataccgggttcaattctcagtggaaacaacgtttggccaatgtgcatgcc 4736651  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| |  ||||  ||||||||| |||| |||||||||||||||| ||||||||||||    
4736652 tctacgtacaagccgaattagtcgcccaccgttggtgggtcggaaac-ggtgcgaaagcc 4736710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 14858666 - 14858824
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||| |||||| || ||| |||||||||||||| | ||||| || |||||||||||||| || ||| ||||| ||| | ||| |||||||||||| |    
14858666 ttgtttgagctccattgacaatgaactccttccaaggatgtacccggagaataccgggttcggttcccagggggatcaa-gcttgaccagtgcgcatgtc 14858764  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||| | ||| ||||||| |||  |||||||| |||||| ||||| ||||||||||||    
14858765 tctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaaagcc 14858824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 48 - 158
Target Start/End: Complemental strand, 48834807 - 48834698
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaact 147  Q
    ||||||||||||||||||||| |||||| ||   | ||||||||| ||||||||||  |||||| | ||||||||||  ||||||||||||||||||||     
48834807 gaataccgggttcgatttcca-ggggaataatactaggccagtgcacatgcctctatacatgagtcggattagtcgcctacctttggtgggtcggaaacc 48834709  T
148 ggtgcgaaagc 158  Q
    |||||||||||    
48834708 ggtgcgaaagc 48834698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 69 - 146
Target Start/End: Original strand, 46108715 - 46108792
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||||  ||||| ||||||||||||||||||||||||||||||||||||  ||| |||| ||||||||||||    
46108715 aggggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaac 46108792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 12703697 - 12703577
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||  |||||| ||| |||||| || ||||||| | ||||||||||||  |||||||||| ||| |||||| | ||| |||||    
12703697 ttgggctccagtggcaaggagatccttcaaaggacgtactcgaggaatactgagttcgatttccagtgggaacaacgcttgaccagtgtgtatgtctcta 12703598  T
104 cgcatgagccagattagtcgc 124  Q
    ||||| |||| ||||||||||    
12703597 cgcataagccggattagtcgc 12703577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 74 - 157
Target Start/End: Complemental strand, 49952228 - 49952144
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc-tcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| |||| ||||||||| ||||||||||||||||| |||||||||| ||||||||| ||||| |||||| ||||||||||    
49952228 aacaacgtttggtcagtgcgcacgcctctacgcatgagccggattagtcgcgtcacctttgatgggttggaaaccggtgcgaaag 49952144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 49 - 159
Target Start/End: Original strand, 21192646 - 21192754
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactg 148  Q
    |||||||||||||| |||| |||  ||||||| | |||||||||||||||||||||||| ||| | ||||| |||| ||| ||||||| |||| |||| |    
21192646 aataccgggttcgagttccgagg--aacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccg 21192743  T
149 gtgcgaaagcc 159  Q
    |||||||||||    
21192744 gtgcgaaagcc 21192754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 58 - 156
Target Start/End: Original strand, 14859304 - 14859402
Alignment:
58 ttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||| || | ||||||| | ||| |||||||||||| ||||||||| ||||||||||||||   |||||||| || |||||||||||||||||||    
14859304 ttcgattttcaggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaaa 14859402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 73 - 159
Target Start/End: Original strand, 50485971 - 50486057
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||  |||||||||||||||| ||||| |||||||||| |||| || ||||||||||||| | ||| ||||||    
50485971 gaacaacgattggccagaacgcatgcctctacgcacgagccggattagtcgcccaccattagtgggtcggaaaccgatgcaaaagcc 50486057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 73 - 158
Target Start/End: Original strand, 8424582 - 8424667
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| |||||||||||||||||||||| ||| |||||| |||| ||||||| ||||||||||||| |||  | |||||||||    
8424582 gaacaacgtttggccagtgcgcatgcctctatgcacgagccaaattaatcgctcatctttggtgggtcgaaaatcgatgcgaaagc 8424667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 15829654 - 15829811
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| || ||| |||| ||||| |||| ||||| |  ||| ||||| || ||| | ||||  |||||||||||||||||     
15829654 ttgtttgggctccagtgacaaggagcttctttcaaggacgtatccggagaatatccagtttgattttcaggggaatcaacacttggccagtgcgcatgct 15829753  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||||||| ||||||||   |||| ||||||| || ||||| ||||||||||    
15829754 tctaggcatgagccggattagtcctccaccattggtggatcagaaaccggtgcgaaag 15829811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 42722534 - 42722378
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||||||||  |||| |||||| |||  | ||||| ||||||||||||||| |||| ||| ||||||||||  ||| ||||||||||| ||    
42722534 ttgtttggactccagtggagaggagctcctttcaaagatgtacccggggaataccgggtttgattccca-ggggaacaacacttgaccagtgcgcatacc 42722436  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||||| | |||||||||  ||||  |||||||||| |||  ||||||||||    
42722435 tctatgcatgagtcggattagtcgtccaccaatggtgggtcgaaaatcggtgcgaaag 42722378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 13552069 - 13552133
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    |||||||||||||||||||||||| ||||||||||| ||||| |||||||||| |||||||||||    
13552069 ttgtttgggctccagtggcaaggagctccttccaagcacgtatccggggaatatcgggttcgatt 13552133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 18531478 - 18531633
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||  | ||| ||||||||||||| | |||||||||    || |||  ||| ||||||||||  |||| ||||||||||||||| |    
18531478 ttgggctctagtggcaaaaagctcattccaagaacgtatctggggaatactatatttgatccccagggggaacaacacttggtcagtgcgcatgcctcca 18531577  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||| || |||||||| |||  ||||||| ||||||||||||| ||||||||||||    
18531578 tgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaagcc 18531633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 34667758 - 34667695
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgat 63  Q
    |||||||||||| ||||||||||| ||||||||||| ||||| |||||||||||||||||||||    
34667758 ttgtttgggctctagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgat 34667695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 5 - 97
Target Start/End: Complemental strand, 27531809 - 27531717
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    |||| ||||||||||||||| ||||||||||| ||||| || ||||||||||||||||| |||| | |||||||| | ||||||| ||||||||    
27531809 ttggactccagtggcaaggagctccttccaaggacgtacccagggaataccgggttcga-ttcccatgggaacaatgcttggccaatgcgcatg 27531717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 70 - 159
Target Start/End: Original strand, 35359761 - 35359850
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| ||| |||||||||||||||| |||||| ||   |||||||||| |||  | |||||||||||||| ||||||||||||    
35359761 ggggaacaacgtttgaccagtgcgcatgcctcaacgcataagttggattagtcgcccactataggtgggtcggaaaccggtgcgaaagcc 35359850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 99 - 159
Target Start/End: Complemental strand, 25406620 - 25406560
Alignment:
99 ctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||  ||||||||||| ||||||||| |||||||||||| ||||||||||||    
25406620 ctctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaaagcc 25406560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 82 - 146
Target Start/End: Original strand, 54946286 - 54946350
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| |||| |||||||||||||||||||||| |||||||||| || | ||||||||||||||||    
54946286 ttggtcagtccgcatgcctctacgcatgagccggattagtcgcccatcattggtgggtcggaaac 54946350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 37382500 - 37382622
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| ||||||| ||   |||| || | ||||||| ||||| |||| || || |||||||||||||||| ||| ||||||    
37382500 ttgtttgggctacagtggcaaggagctccttcaaatgtcgtatccagtgaataccaggttcaattttcagggagaacaacgattggccaatgcacatgcc 37382599  T
100 tctacgcatgagccagattagtc 122  Q
    |||| ||| || || ||||||||    
37382600 tctatgcacgaaccggattagtc 37382622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 48317427 - 48317285
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||| || ||| ||||||  |||||  ||   ||||| || |||||||| || | ||||||||| |||| ||||| | |||||||||    
48317427 ttgggctccagtggcaaagagctcattccaatgacgtattcgaaaaatactggattcgattttcaggaggaacaacgcttggtcagtgtgtatgcctcta 48317328  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| ||||| |||||||||| |||| ||| ||||| ||||||    
48317327 cgcacgagccggattagtcgcccaccgttgatgggttggaaac 48317285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 44 - 157
Target Start/End: Original strand, 45721085 - 45721198
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    ||||||||||||||||| |||| || ||| || || | ||||||| ||||| ||||||||||||  || | |||||||||  |||||||  ||||| |||    
45721085 cggggaataccgggttccattttcaggggaaataatgtttggccactgcgcgtgcctctacgcacaagtcggattagtcgtccacctttaatgggttgga 45721184  T
144 aactggtgcgaaag 157  Q
    ||| ||||||||||    
45721185 aaccggtgcgaaag 45721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 43 - 159
Target Start/End: Original strand, 6862223 - 6862337
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||||||||||||||| ||  | |||| ||   |||| ||||||||||| |||||||||  || |  ||||||| |||||||||||| ||||||    
6862223 ccggggaataccgggttcgattccct-gtggaataatacttggtcagtgcgcatgtctctacgcaa-agtcgaattagtcactcacctttggttggtcgg 6862320  T
143 aaactggtgcgaaagcc 159  Q
    |||| ||||||||||||    
6862321 aaaccggtgcgaaagcc 6862337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 112
Target Start/End: Complemental strand, 24850770 - 24850671
Alignment:
13 cagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    |||||||||||| ||| ||||||| ||||| ||||| |||||| | ||| |||  || ||||||||||  ||| ||||||||||||||||||||||||||    
24850770 cagtggcaaggagctcattccaaggacgtatccgggaaataccagattcaattatca-ggggaacaacacttgaccagtgcgcatgcctctacgcatgag 24850672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 33176013 - 33176127
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    ||||||||| ||| |||||||| || ||||||||||| ||| ||| || ||||| |  | | |||||| |||||||||||  ||||||||||| || |||    
33176013 cggggaatatcggattcgattttcagggggaacaacgtttgtccaatgtgcatgtcgattcacatgaggcagattagtcgtccacctttggtgagttgga 33176112  T
144 aactggtgcgaaagc 158  Q
    |||  ||||||||||    
33176113 aaccagtgcgaaagc 33176127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 73 - 158
Target Start/End: Original strand, 9548739 - 9548824
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||  ||||||||||||||| | || || | |||||||||| ||||| ||||||| |||||||||| ||| |||||    
9548739 gaacaacgcttggttagtgcgcatgcctctgcacacgaactagattagtcgttcaccgttggtggatcggaaactgatgcaaaagc 9548824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 19651601 - 19651504
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    ||||||||||||||||||||| || ||||||||||| ||||| |||  ||||||||  ||||||||| |||  |||||| | | ||||||||| ||||    
19651601 ttgtttgggctccagtggcaatgagctccttccaaggacgtatccgaagaataccgaattcgatttcaaagccgaacaatgttcggccagtgcacatg 19651504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 13436783 - 13436858
Alignment:
15 gtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtg 91  Q
    |||| ||||| |||||| |||| |||||| |||||||||||||||||||| |||  |||||||||| |||| |||||    
13436783 gtggtaaggagctcctttcaaggacgtac-ggggaataccgggttcgattcccagagggaacaacgcttggtcagtg 13436858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 158
Target Start/End: Complemental strand, 14597974 - 14597898
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||| || |  |||||||||  |||||||| ||| ||| |||| ||||| |||||    
14597974 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 14597898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 26237561 - 26237422
Alignment:
16 tggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccag 115  Q
    |||||| || |||||| |||||||||||| | |  ||| ||||||||||  || ||| ||||||| |||  ||||||| ||| || |||||||||| | |    
26237561 tggcaaagagctcctttcaagaacgtacccgagg-tactgggttcgattctcaggggaaacaacgtttgatcagtgcgtatgtctttacgcatgagtcgg 26237463  T
116 attagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||| |  |||| ||| |||||||||||||| |||||||    
26237462 attagtagtccaccattgatgggtcggaaactgatgcgaaa 26237422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 33109277 - 33109400
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacg--attggccagtgcgcatg 97  Q
    |||||||||||| |||||| || | ||||||||||| | ||| |||||| ||| ||||||| ||| ||| |  ||||||||   ||||||||| ||||||    
33109277 ttgtttgggctctagtggcgagaagctccttccaaggaggtatccgggggatatcgggttcaattcccatgaagaacaacgctcttggccagtacgcatg 33109376  T
98 cctctacgcatgagccagattagt 121  Q
     ||||||||| ||||| |||||||    
33109377 tctctacgcacgagccggattagt 33109400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 45 - 159
Target Start/End: Original strand, 14567959 - 14568067
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||| |||||||||  || || ||| |||| ||| ||||||| ||| |||||||||| ||| | ||||||||||      | ||||||||||||    
14567959 ggggaataccaggttcgattctcagggagaataacgcttgaccagtgcacatacctctacgcacgagtcggattagtcgc------tgggtgggtcggaa 14568052  T
145 actggtgcgaaagcc 159  Q
    || ||||||||||||    
14568053 accggtgcgaaagcc 14568067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 83 - 146
Target Start/End: Original strand, 37194848 - 37194911
Alignment:
83 tggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||| |||||||||||||||||||| ||||||| || |  | ||| ||||||||||||    
37194848 tggccagtgcacatgcctctacgcatgagccggattagttgcccgtcattgatgggtcggaaac 37194911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 86 - 145
Target Start/End: Original strand, 53354573 - 53354632
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    ||||||||||||||||||||||| |  | ||||||||| ||| ||||| |||||||||||    
53354573 ccagtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtcggaaa 53354632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 71 - 157
Target Start/End: Complemental strand, 37369127 - 37369041
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| ||| |||||| ||||||||||||||| ||| | ||| |||||| |||  ||||||  |||||||| | ||||||||    
37369127 gggaacaacgtttgtccagtgtgcatgcctctacgcacgagtcggataagtcgcccactattggtgaatcggaaaccgatgcgaaag 37369041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 2686611 - 2686454
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||  ||||||||||| ||  ||||||  |||||| ||| ||||| | | |||||||| || ||| ||||||  ||| ||| | |  ||| |    
2686611 ttgtttgggctttagtggcaaggagctttttccaaagacgtactcggagaatatcagattcgattttcaggggaaacaacacttgaccactacatatgtc 2686512  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| ||||||||  ||||||||  ||||||| |||||| |||||| ||||||||||    
2686511 tctacacatgagccgaattagtcgtccaccttttgtgggttggaaaccggtgcgaaag 2686454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 69 - 158
Target Start/End: Original strand, 17946513 - 17946602
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||   ||| ||||||||||||| ||||| |||||| ||||||||| |  ||| ||||||| |||| |||| | |||||||||    
17946513 aggggaacaattcttgaccagtgcgcatgcttctacacatgagtcagattagttgtccacttttggtgagtcgaaaaccgttgcgaaagc 17946602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 4 - 124
Target Start/End: Complemental strand, 55005459 - 55005338
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    |||||||||  ||||||| || ||||||||||  ||||| | ||||| |||||  |||||||  || ||| ||||||| ||| ||| |||||||||||||    
55005459 tttgggctctggtggcaatgagctccttccaaagacgtatctgggaaataccgaattcgattcgcaggggaaacaacgcttgaccattgcgcatgcctct 55005360  T
103 acgcatgagccagattagtcgc 124  Q
    |||||  || | ||||||||||    
55005359 acgcacaagtcggattagtcgc 55005338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 74 - 142
Target Start/End: Original strand, 23788426 - 23788494
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    ||||||| || | ||||||||||||||||||||| ||||  ||||||||| |||  |||| ||||||||    
23788426 aacaacgtttagtcagtgcgcatgcctctacgcacgagctggattagtcgttcatttttgatgggtcgg 23788494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 99; Significance: 1e-48; HSPs: 93)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 5855473 - 5855631
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| |||||  ||||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||    
5855473 ttgtttgggctccagtggcaaggagctccttccaaggacgtattcggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcc 5855572  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| | ||||||||| |||||||| ||||||||||||| | |||||||||    
5855573 tctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc 5855631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 18915818 - 18915977
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| || |||||||| ||||||| |||||||||||||||||||| ||| ||||||||||  |||||||||| |||||||    
18915818 ttgtttgggcttcagtggcaaggagcttcttccaaggacgtacccggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgcc 18915917  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| ||||||||||||||| ||||||||| |||||| ||||||||||||    
18915918 tctacgcacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaagcc 18915977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 41664013 - 41663854
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||||||| ||| ||||||||||  |||| |||||||||||||    
41664013 ttgtttgggctccagtggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggtcagtgcgcatgcc 41663914  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||  |||||||||  |||| |||||||||||||||| ||||||||||||    
41663913 tctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 41663854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 49078069 - 49078224
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||||||| ||| ||| ||||||  ||||||||||||||||||||||    
49078069 ttgggctccagtggcaaggagctccttctaaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctcta 49078168  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||| ||||| ||||| |||||||||| ||||||||||||    
49078169 cgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaagcc 49078224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 16 - 159
Target Start/End: Original strand, 34719742 - 34719886
Alignment:
16 tggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    ||||||||| ||||||||||| ||||||| ||||||||| |||||||||| |||  ||||| |||| ||| |||||||||||||||||||||| ||| ||    
34719742 tggcaaggagctccttccaaggacgtacctggggaatactgggttcgattcccactgggaataacgcttgaccagtgcgcatgcctctacgcacgagtca 34719841  T
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
34719842 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 34719886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 17642161 - 17642002
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| |||||| ||||||||| | |||||||  |||| ||| |||||||||| ||| ||||||||||  ||||||||||||||||||    
17642161 ttgtttgggctccagtgacaaggagctccttccacggacgtacccaggaaatactgggttcgattcccagggggaacaacacttggccagtgcgcatgcc 17642062  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||  ||||||||||||||||||||||||||||||||||    
17642061 tctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagcc 17642002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 8763946 - 8764101
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||| |||||||||| ||||||||||| ||||||| |||||||| |||||||| || ||| ||||||||||  ||||||||||||||||||||||    
8763946 ttgggctcccgtggcaaggagctccttccaaggacgtacccggggaatatcgggttcgtttcccagggggaacaacacttggccagtgcgcatgcctcta 8764045  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||  |||| |||||||||||||||| ||||||||||||    
8764046 cgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaagcc 8764101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 43959974 - 43959819
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||  ||||||||||  ||||||| |||||||| ||||||| ||| ||| ||||||||||| ||||||||||||||||||||||    
43959974 ttgggctccagtggcaaggtgctccttccaatgacgtacccggggaatatcgggttcaattcccagggggaacaacgcttggccagtgcgcatgcctcta 43959875  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| ||||| |||||||||| ||||||| |||| |||||||| ||||||||||||    
43959874 cgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagcc 43959819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 4 - 158
Target Start/End: Complemental strand, 45362036 - 45361881
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    |||||||| |||||||||||| ||||||||||| |||||||  |||||||||||||||||||  || | ||||||||| |||||||||||||||||| ||    
45362036 tttgggcttcagtggcaaggagctccttccaaggacgtaccctgggaataccgggttcgattctcaggaggaacaacgcttggccagtgcgcatgccact 45361937  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||| |||| ||||||||| |||||||| ||||||||||||| |||||||||||    
45361936 acgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 45361881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 10422739 - 10422897
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| ||||||||||  |||||  ||||||||||||||||||||||| | | ||||||||  ||||||||||||||||||    
10422739 ttgtttgggctacagtggcaaggagctccttccaatgacgtattcggggaataccgggttcgatttctaggaggaacaacacttggccagtgcgcatgcc 10422838  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||| |||||||||  ||||||||||  ||||||||| |||||||||||    
10422839 tctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaagc 10422897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 32143002 - 32142845
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||||| || ||||||||| || ||| ||||||| |||||||  ||||||||||||||||||| || ||||||||||  |||||||||||||||||||    
32143002 ttgtttggacttcagtggcaaagagctcattccaaggacgtaccctggaataccgggttcgattttcagggggaacaacacttggccagtgcgcatgcct 32142903  T
101 ctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
     ||||||||||||  |||||||||||||||||| |||||||||||| | |||||||||    
32142902 ttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaagc 32142845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 10173128 - 10172970
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||  ||||||||||| ||||| | |||||||||||| ||| ||| |||    |||||||| ||||||||||| ||||||    
10173128 ttgtttgggctccagtggcaaggtgctccttccaaggacgtatctggggaataccggattcaattcccataaagaacaacgcttggccagtgcccatgcc 10173029  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||| ||||| |||| ||||||||||||||||||||| |||||||||||    
10173028 tctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaagc 10172970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 11398041 - 11397888
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| | ||| |||| ||||||||||||||||| || |||||||||||| ||||||| |||| |||||||||    
11398041 ttgggctccagtggcaaggagctccttccaaggatgtatccggagaataccgggttcgatt-ccgaggggaacaacgtttggccaatgcgtatgcctcta 11397943  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| | |||||||||  ||||||||||||||||||||  |||||||||||    
11397942 cgcatgagtcggattagtcgtccacctttggtgggtcggaaatcggtgcgaaagc 11397888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 7 - 159
Target Start/End: Original strand, 26325769 - 26325922
Alignment:
7 gggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacg 105  Q
    |||||||||||||||||| |||||| |||| ||||| ||| |||||| ||||||||||| |||  |||||||||  |||| |||||||||||||||||||    
26325769 gggctccagtggcaaggagctcctttcaaggacgtatccgaggaatatcgggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacg 26325868  T
106 catgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||||||  |||| |||||||||||||||| ||||||||||||    
26325869 catgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagcc 26325922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 9659328 - 9659178
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||||||||||| ||| ||| ||| |||||| ||||||||||||||||||||| ||| ||||||||||| ||| | ||||||||||||| |||||    
9659328 ggctccagtggcaaggagctcattctaaggacgtactcggggaataccgggttcgattccca-ggggaacaacgtttgactagtgcgcatgcctttacgc 9659230  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||| |||||||||  |||||||||||||| |||||| |||||||||||    
9659229 atgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaagc 9659178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 4 - 158
Target Start/End: Complemental strand, 30927881 - 30927726
Alignment:
4 tttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctct 102  Q
    ||||| ||||||||||||||| ||||||||||| ||||||| ||||| || |||||||||||||||  |||||||||| ||||||| || ||||||||||    
30927881 tttggactccagtggcaaggagctccttccaaggacgtacctgggaaatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctct 30927782  T
103 acgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| |||||||||  ||| ||||||||||| ||||| ||||| |||||    
30927781 acgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgcaaaagc 30927726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 32151079 - 32150921
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||   || |||||| | ||||||||||||| ||||||||||  |||| |||||||||||||    
32151079 ttgtttgggctccagtggcaaggagctccttccaaggacgttttcgaggaatatcaggttcgatttccagggggaacaacatttggtcagtgcgcatgcc 32150980  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    | ||||||||||||  |||||||||||||||||| ||||||| |||| | |||||||||    
32150979 tttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccgatgcgaaagc 32150921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 40288630 - 40288488
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||| ||||||| |||||  ||||||||||||||||||||||||| ||||||||||| |||||||||  |||||||||||    
40288630 ttgggctcgagtggcaaggagctctttccaaggacgtattcggggaataccgggttcgatttccagggggaacaacggttggccagtatgcatgcctcta 40288531  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    | || ||||| ||||||||||||| | ||||||||||||||||    
40288530 cacacgagccggattagtcgctcatccttggtgggtcggaaac 40288488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 16 - 158
Target Start/End: Original strand, 16956432 - 16956575
Alignment:
16 tggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcca 114  Q
    ||||||||| ||||||||||| ||||||| ||||||||||| ||||| ||  || ||| ||||||| ||| |||||||||||||||||||||| |||||     
16956432 tggcaaggagctccttccaaggacgtacccggggaataccgtgttcggttctcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccg 16956531  T
115 gattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| |||||||||||||||||||||||  ||||||||||    
16956532 gattagtcactcacctttggtgggtcggaaaccagtgcgaaagc 16956575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 15238259 - 15238105
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||| |||||||  ||||||| ||||||||||| ||| ||||| ||||| ||||||| || |||||||||||    
15238259 ttgggctccaatggcaaggagctccttccaaggacgtacctagggaatatcgggttcgattcccagggggagcaacgcttggccaatgagcatgcctcta 15238160  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||  || |||||||||||||||||||||||| |||||| ||| |||||||    
15238159 cgcacgaatcatattagtcgctcacctttggtgggttggaaaccggttcgaaagc 15238105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 15465916 - 15466062
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||| ||| |  ||||||||||| |||||   |||||||||| ||||||||||||| ||||||||||| |||| |||||| ||||||    
15465916 ttgtttgggctccagtgacaaagggctccttccaaggacgtatttggggaataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcc 15466015  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||| ||| | |||| |||||||||||||||||||||||||||    
15466016 tctacgcacgagtctgattggtcgctcacctttggtgggtcggaaac 15466062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 26660133 - 26660246
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    ||||||||||||||||||||||||| ||||||||||  |||  |||| |||||||||||||||||||||| |||||||||| ||||||||||||||||||    
26660133 cggggaataccgggttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcgc-cacctttggtgggtcgga 26660231  T
144 aactggtgcgaaagc 158  Q
    ||| |||||||||||    
26660232 aaccggtgcgaaagc 26660246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 33418272 - 33418126
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||  ||||||| || ||||||||| ||||||| | | |||| |||||| ||||||||||||||||||    
33418272 ttgtttgggctccagtggcaaggagctccttccaaagacgtacccggagaataccggattcgattcctaggggggacaacgcttggccagtgcgcatgcc 33418173  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| ||| ||||| |||||||||  |||||||||| ||||||||||    
33418172 tctatgcacgagccggattagtcgtccacctttggtcggtcggaaac 33418126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 48798227 - 48798105
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||| |||||||||||||||||| ||||||||||  ||||| |||||||||| ||||||||||||||| ||||||||||| ||| | ||||||||||||    
48798227 ttgttggggctccagtggcaaggagctccttccaatgacgtatccggggaatatcgggttcgatttccagggggaacaacgcttgactagtgcgcatgcc 48798128  T
100 tctacgcatgagccagattagtc 122  Q
    |||||||||||||| ||||||||    
48798127 tctacgcatgagccggattagtc 48798105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 10 - 146
Target Start/End: Complemental strand, 14254416 - 14254279
Alignment:
10 ctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcat 108  Q
    |||||| |||||||||||| ||||||| |||||  |||||||||||| ||||||||| || ||||||||||| ||||||||| ||||||||| |||||||    
14254416 ctccaggggcaaggaactcattccaaggacgtattcggggaataccgagttcgattttcagggggaacaacgcttggccagtacgcatgcctttacgcat 14254317  T
109 gagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||| |||||||||  |||||||| ||||||||||||    
14254316 gagccggattagtcgtccacctttgatgggtcggaaac 14254279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 37339795 - 37339930
Alignment:
26 ctccttccaagaacgtacc-ggggaataccgggttcgatttccaagggga-acaacgattggccagtgcgcatgcctctacgcatgagccagattagtcg 123  Q
    ||||||||||| | ||||| |||||||||||||||||||| ||| ||||  |||||| |||||||||||||||||||| ||||| ||||| |||||||||    
37339795 ctccttccaaggatgtacccggggaataccgggttcgattcccagggggggacaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcg 37339894  T
124 ctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    | |||||||||||||| |||||| ||||||||||||    
37339895 cccacctttggtgggttggaaaccggtgcgaaagcc 37339930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 47313055 - 47312933
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| ||  |||||||||| ||||| | ||||||||||||||| |||| || |||||||||||| |||||||||||| |||||    
47313055 ttgtttgggctccagtggcaacgagatccttccaaggacgtatctggggaataccgggtttgatt-cctaggggaacaacgtttggccagtgcgtatgcc 47312957  T
100 tctacgcatgagccagattagtcg 123  Q
    ||||||||||||||||||||||||    
47312956 tctacgcatgagccagattagtcg 47312933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 33004168 - 33004015
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||   |||| ||||||||||| ||||| |||||||||| ||| ||||||||||| ||| ||||| | ||||||||||||||||||||||    
33004168 ttgggctccagtgatgaggagctccttccaaggacgtatccggggaatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctcta 33004069  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||| |||||||| | ||||  |||||||||| |||| ||||||||||    
33004068 cgcacgagccggattagtcacccaccaatggtgggtcgaaaaccggtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 20 - 139
Target Start/End: Complemental strand, 18708678 - 18708558
Alignment:
20 aaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatt 118  Q
    |||||||||||||||||||| |||| | ||||||| |||||||||||||| ||| | ||| | ||||| ||||||||||||||||| |||||||||||||    
18708678 aaggaactccttccaagaacatacctgaggaatactgggttcgatttccaggggaagcaatgcttggctagtgcgcatgcctctacacatgagccagatt 18708579  T
119 agtcgctcacctttggtgggt 139  Q
    ||||||||||||||| |||||    
18708578 agtcgctcacctttgatgggt 18708558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 50503518 - 50503360
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||| ||| ||| |||||| |||| |||||| |||| ||||| |||||||||| ||||||||||| ||| ||||||||||  ||| ||||||||||||||    
50503518 ttgtatggactctagtggcgaggagctcctttcaaggacgtatccggggaatatcgggttcgattcccagggggaacaacacttgaccagtgcgcatgcc 50503419  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||||| |||| ||||| ||||  ||||||||||||||| | |||||||||    
50503418 tctacgcacgagccggatttgtcgcccaccaatggtgggtcggaaaccgatgcgaaagc 50503360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 2567227 - 2567384
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| || ||||||||| ||||||||||| |||||  ||| |||||||||||||||||| |  ||  ||||||| ||||||||||||||||||    
2567227 ttgtttgggcttcactggcaaggagctccttccaaggacgtattcggagaataccgggttcgattttcggggaaaacaacgcttggccagtgcgcatgcc 2567326  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||| || ||| |||||||| ||  || |||||||||||||||||| ||| ||||||    
2567327 tctactcacgagtcagattagccgtccatctttggtgggtcggaaaccggtacgaaag 2567384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 6 - 146
Target Start/End: Original strand, 10336472 - 10336613
Alignment:
6 tgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||| |||||||||||||| ||||||||||  ||||| |||| ||||| |||||||||||| || ||||||||||| ||| |||||||||||||||||||    
10336472 tgggttccagtggcaaggagctccttccaaagacgtatccggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctac 10336571  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||| ||||| |||  |||||||| ||| ||| ||||    
10336572 gcatgagccggattaatcgtccacctttgatggatcgaaaac 10336613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 12036901 - 12036756
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| |||||||| | ||||||||||| |||||||  | |||||| ||||| |||| | | ||||||||| | ||||||||||||||||||    
12036901 ttgtttgggctccggtggcaagaagctccttccaaggacgtacctagagaatactgggtttgattcctagggggaacaatgcttggccagtgcgcatgcc 12036802  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||||||| ||||||||||| |||  |||||||||||| |||||||    
12036801 tctacgcacgagccagattaatcgtccacctttggtggatcggaaa 12036756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 45726586 - 45726433
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||| |||| || |||| |||||| ||||||| | |||||||| |||||||||  || | |||| |||  |||||||||||| ||| |||||    
45726586 ttgggctccagttgcaaagacctccctccaaggacgtacccgaggaatacctggttcgattctcaggaggaataacatttggccagtgcgtatgtctcta 45726487  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||| ||||||||| ||||||||||||| ||||| |||||||||||||    
45726486 cgcatgagccggattagtcgttcacctttggtggatcggagactggtgcgaaag 45726433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 32822 - 32945
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgggg-aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||||||||||| ||||||||||| |||| ||||| ||||| ||| | ||||||||| |||| |||||| ||||||    
32822 ttgtttgggctccagtggcaatgagctccttccaaggacgtaccgggggaatatcgggtccgattcccaggaggaacaacgcttggtcagtgcacatgcc 32921  T
100 tctacgcatgagccagattagtcg 123  Q
    ||||||||||||||  ||||||||    
32922 tctacgcatgagccgaattagtcg 32945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 2981084 - 2980930
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||||||||| | ||||| ||||||||||| |||||||||| |||  |||||||||  |||||||||| |||||||||||    
2981084 ttgggctctagtggcaaggagctccttccagggacgtatccggggaatactgggttcgattcccagcgggaacaacacttggccagtgtgcatgcctcta 2980985  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||| | |||||||||  ||  ||| ||||||||||||  |||||||||||    
2980984 cgcacgagtcggattagtcgtccatgtttagtgggtcggaaatcggtgcgaaagc 2980930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 5503982 - 5504139
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| |||||||||||||| |||||||| |||||||| | |||||||| | |||||||||  || ||  ||||||| |||   ||||| ||||||    
5503982 ttgtttgggttccagtggcaaggagctccttccgagaacgtatctggggaatatcaggttcgattctcagggaaaacaacgcttgattagtgcacatgcc 5504081  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| |||||||||  |||||||| |||||||||||| ||| ||||||    
5504082 tctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaag 5504139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 15 - 159
Target Start/End: Original strand, 34697300 - 34697445
Alignment:
15 gtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagcc 113  Q
    |||||||||| |||||||||| ||||||  ||||||||||| |||||||||   | ||||||||||  ||||| |||| |||||||||||||||||||||    
34697300 gtggcaaggagctccttccaaaaacgtattcggggaataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagcc 34697399  T
114 agattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     |||||||||| ||| |||| ||||| |||||| | ||||||||||    
34697400 ggattagtcgcccacttttgatgggttggaaaccgatgcgaaagcc 34697445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 45 - 157
Target Start/End: Original strand, 16263541 - 16263653
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||| ||||||||||||| | ||||||||| ||||||||||||||||||||||||||| |||| || ||||||  ||| |||| ||| ||||||    
16263541 ggggaataccaggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaa 16263640  T
145 actggtgcgaaag 157  Q
    || ||||||||||    
16263641 accggtgcgaaag 16263653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 26 - 157
Target Start/End: Complemental strand, 18649484 - 18649352
Alignment:
26 ctccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgc 124  Q
    ||||||||||| ||||| | || ||||| |||||||||||| || ||||||||||| ||| |||||||||||||||||||| | ||||||||||| ||||    
18649484 ctccttccaaggacgtatctggagaatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaatcgc 18649385  T
125 tcacctttggtgggtcggaaactggtgcgaaag 157  Q
     ||||||| |||| | |||||| ||||||||||    
18649384 ccacctttagtggattggaaaccggtgcgaaag 18649352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 892454 - 892300
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| |||||| |||| |||||  ||||||||||||||||||||| | | ||||||||||  || |||| || ||||||     
892454 ttgtttgggcttcagtggcaaggagctcctttcaaggacgtattcggggaataccgggttcgattcctagggggaacaacacttagccaatgtgcatgc- 892356  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
        |||||||||| |||||||||| |||||||||||| |||||||  ||||||||||||    
892355 ----cgcatgagccggattagtcgcccacctttggtggatcggaaatcggtgcgaaagcc 892300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 9853430 - 9853275
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| | ||||| || || |||||||||||||| | | ||| ||||||| ||  ||||||||||||||||||    
9853430 ttgggctccagtggcaaggagctccttccaaggatgtacccggaaaataccgggttcgattcctaggggaaacaacgttttaccagtgcgcatgcctcta 9853331  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    | || || |||||||| |||  ||||||||||||||| ||||  ||||| ||||||    
9853330 cacacgaaccagattaatcgtccacctttggtgggtcagaaatcggtgcaaaagcc 9853275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 12744680 - 12744521
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||||||| ||  |||||||||||||| ||||| | | |||||| | | |||||||| || ||||||||||| ||| | |||||||||| |    
12744680 ttgtttggactccagtgacattgaactccttccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtc 12744581  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||  |||||||||||||  |||||||||| ||||| | ||||||||||    
12744580 tctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagcc 12744521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 12755670 - 12755511
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||||||| ||  |||||||||||||| ||||| | | |||||| | | |||||||| || ||||||||||| ||| | |||||||||| |    
12755670 ttgtttggactccagtgacattgaactccttccaaggacgtatctgaggaatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtc 12755571  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||  |||||||||||||  |||||||||| ||||| | ||||||||||    
12755570 tctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagcc 12755511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 31152667 - 31152825
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||| ||||||| | |||||  ||||||||||||||||||||||  |||||| |||| |||| |||||||| ||||    
31152667 ttgtttgggctctagtggcaaggagctctttccaaggatgtacccagggaataccgggttcgatttcccgggggaataacgcttggtcagtgcgcgtgcc 31152766  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| || ||| || ||||||||  ||||||||||| || ||| || ||||||||||||    
31152767 tctacacacgagtcaaattagtcgtccacctttggtgagttggagac-ggtgcgaaagcc 31152825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 5 - 142
Target Start/End: Original strand, 25165357 - 25165493
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| |||||||||||| |||||| |||||||||||| |||||||  || ||||||||||  |  |||||||||||||||||||    
25165357 ttgggctctagtggcaaggagctccttccaaga-cgtacctggggaataccggattcgattatca-ggggaacaacactctgccagtgcgcatgcctcta 25165454  T
104 cgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
     |||  |||| |||||||| |||||||||||||||||||    
25165455 ggcacaagccggattagtcactcacctttggtgggtcgg 25165493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 54 - 157
Target Start/End: Complemental strand, 21849307 - 21849205
Alignment:
54 cgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcg 153  Q
    ||||||||||| ||| ||||||||||| ||||| |||||||||||||||||||| ||||| ||||||||||||||  ||||||||||| |||| ||| ||    
21849307 cgggttcgattccca-ggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacg 21849209  T
154 aaag 157  Q
    ||||    
21849208 aaag 21849205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 5 - 107
Target Start/End: Original strand, 45536664 - 45536766
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| |||||| |||||||| ||||||  ||||||| || ||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||    
45536664 ttgggctctagtggcgaggaactc-ttccaatgacgtacccggagaataccgggttcgatttctaaggggaacaacgcttggccagtgcacatgcctcta 45536762  T
104 cgca 107  Q
    ||||    
45536763 cgca 45536766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 33498992 - 33498838
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||  |||||  ||| | ||||| || || ||||||||||||||  || | ||| ||||| ||||||||||||||||||||||    
33498992 ttgggctccagtggcaaggagttccttttaaggatgtacctggaaaataccgggttcgattctcaggaggagcaacgcttggccagtgcgcatgcctcta 33498893  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| |||||||||  |||||||| ||| ||| |||  ||| |||||||    
33498892 cgcatgagccggattagtcgtccacctttgatggatcgtaaagcggtacgaaagc 33498838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 34877941 - 34878059
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| | ||||||||| |||||  ||||||||||| ||||||||| | | | ||||||||  ||||||||||||||||||    
34877941 ttgtttgggcttcagtggcaaggagcaccttccaaggacgtattcggggaataccaggttcgattcctaggcggaacaacacttggccagtgcgcatgcc 34878040  T
100 tctacgcatgagccagatt 118  Q
    ||||| || ||||||||||    
34878041 tctacacacgagccagatt 34878059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 14 - 159
Target Start/End: Complemental strand, 41696741 - 41696596
Alignment:
14 agtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagc 112  Q
    |||||||| || ||||||||||| ||||| | | ||||||| |||||||||||||| |||||  |||  ||| |||||| | ||||||||||||| ||      
41696741 agtggcaatgagctccttccaaggacgtatctgaggaatac-gggttcgatttccagggggattaacacttgaccagtgtgtatgcctctacgcacgaat 41696643  T
113 cagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||||||||||||| ||| |||||||||| ||||||||||    
41696642 cagattagtcgctcacctttgatggatcggaaactgatgcgaaagcc 41696596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 121
Target Start/End: Original strand, 6563396 - 6563513
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||| ||||||||||| | ||||| |  ||| ||||||||||||| | | ||||||||||| ||||||||||| |||| |||||    
6563396 ttggactccagtggcaaggagctccttccaaggatgtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctcta 6563495  T
104 cgcatgagccagattagt 121  Q
    |||| |||||||||||||    
6563496 cgcacgagccagattagt 6563513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 82 - 158
Target Start/End: Complemental strand, 4581757 - 4581681
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||| ||||| || ||||||  ||||||||||||||||||||| |||||||||||    
4581757 ttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4581681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 19 - 145
Target Start/End: Original strand, 48761145 - 48761272
Alignment:
19 caaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagat 117  Q
    |||||||||||||||||||| ||| || || ||||| || |||||||| |||| ||||||||| |||| |||||  |||||||||||||| ||||  |||    
48761145 caaggaactccttccaagaatgtatcccggaaatactggattcgattttcaagaggaacaacgtttggtcagtggacatgcctctacgcacgagctggat 48761244  T
118 tagtcgctcacctttggtgggtcggaaa 145  Q
    ||||||  |||||||||| |||||||||    
48761245 tagtcgtccacctttggtcggtcggaaa 48761272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 34334439 - 34334353
Alignment:
14 agtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| ||| ||||||| ||||| |||||||||||||||||||||| ||| ||||||||||  ||||||||||||||||||    
34334439 agtggcaaggagctcattccaaggacgtatccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcc 34334353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 9 - 157
Target Start/End: Original strand, 14357714 - 14357863
Alignment:
9 gctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgca 107  Q
    ||||||||||||||||  | |||||||| ||||| | || || || | ||||||||||||||  | ||||||| ||| ||||||||||||||||||||||    
14357714 gctccagtggcaaggagtttcttccaaggacgtatctggaaaatatcaggttcgatttccaattgaaacaacgtttgaccagtgcgcatgcctctacgca 14357813  T
108 tgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
     || || ||||| ||| | ||| ||| |||||||||||| ||||||||||    
14357814 cgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaag 14357863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 44 - 154
Target Start/End: Complemental strand, 17092590 - 17092480
Alignment:
44 cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgga 143  Q
    |||| |||| || ||||||||| || ||| |||||||||||||||||| | ||||||||||||| ||||| |||||||||  |||||||||| | || ||    
17092590 cgggaaatatcgagttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcgtccacctttggtagatcaga 17092491  T
144 aactggtgcga 154  Q
    ||| |||||||    
17092490 aaccggtgcga 17092480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 17358628 - 17358482
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||  | ||||||||||| ||| || |||| |||||   ||||||||||||||||||||  || || |||||||| ||| ||| ||||||||||    
17358628 ttgtttgggagctagtggcaaggagctcatttcaaggacgtatttggggaataccgggttcgattctcagggagaacaacgcttgaccaatgcgcatgcc 17358529  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    | |||||||||||| ||||||| | ||| |||| ||||||| |||||    
17358528 tttacgcatgagcccgattagttgttcatctttagtgggtcagaaac 17358482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 8905307 - 8905211
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatg 97  Q
    |||||||| ||| ||||||||||| ||||||||||  ||||| |||| ||||| ||||| ||||||| ||||||||||||| ||||||||||||||||    
8905307 ttgtttggactctagtggcaaggagctccttccaatgacgtatccggagaatatcgggtacgatttc-aaggggaacaacgcttggccagtgcgcatg 8905211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 31576704 - 31576547
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||| ||| ||| ||||| || |  ||||||||||||||||  || ||| ||||| | ||||||| ||||  ||||    
31576704 ttgtttgggctctagtggcaaggagctcattctaaggacgtatcccgaaaataccgggttcgattctcaggggaaacaatgcttggccaatgcgtgtgcc 31576605  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| | |||||||  || ||||| || ||||||||| ||||| ||||    
31576604 tctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgcaaaag 31576547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 54 - 159
Target Start/End: Complemental strand, 35211275 - 35211170
Alignment:
54 cgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcg 153  Q
    |||||||||||||||   ||||||| | || |||| | |||||||||||||||||||||   ||||||||  ||||||||||||||||||||| |||| |    
35211275 cgggttcgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtg 35211176  T
154 aaagcc 159  Q
    ||||||    
35211175 aaagcc 35211170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 46 - 129
Target Start/End: Complemental strand, 28324691 - 28324608
Alignment:
46 gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacc 129  Q
    ||||||| ||||||||||| ||  ||| ||||||  |||| ||||||||||||||||||||||||||| |||||||| ||||||    
28324691 gggaatatcgggttcgattccccggggaaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcactcacc 28324608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 46 - 159
Target Start/End: Original strand, 35908754 - 35908866
Alignment:
46 gggaataccgggttcgatttccaaggggaacaacgatt-ggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    ||||||||||| ||||||||  | ||||||||||  || || ||||||||||||||||||||||||||| |||||||||  |||| |  |||||||||||    
35908754 gggaataccggattcgatttttagggggaacaacactttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccat--gtgggtcggaa 35908851  T
145 actggtgcgaaagcc 159  Q
    || ||||| ||||||    
35908852 accggtgcaaaagcc 35908866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 42744742 - 42744881
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||||||||| || ||||||||||| ||||| || |||||||||||||||||         ||||||||| |||||||||| |||||||||||    
42744742 ttggactccagtggcaatgagctccttccaaggacgtacccagggaataccgggttcga---------ggaacaacgcttggccagtgagcatgcctcta 42744832  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||      ||||| ||||||| |||| |||||||| |||||||||||    
42744833 cgcacgagcc------gtcgcccacctttagtggatcggaaaccggtgcgaaagc 42744881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 72 - 146
Target Start/End: Original strand, 10507721 - 10507795
Alignment:
72 ggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||| |||||||||| |||| |||||||||||||||| |||||||||  ||||  |||||||||||||||    
10507721 ggaacaacgtttggccagtgtgcatacctctacgcatgagccggattagtcgtccaccactggtgggtcggaaac 10507795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 73 - 159
Target Start/End: Original strand, 44969688 - 44969774
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||||||| ||||||| ||||||||||||| |||||||||  || | ||||||| |||||||| |||| |||||||    
44969688 gaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaagcc 44969774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 46929890 - 46929737
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||| | ||||||||||  ||||| | || ||||| || |||||||||||||  | ||||||| ||||||| |||||||||||| |    
46929890 ttgggctctagtggcaagaagctccttccaaagacgtatctggagaatatcgagttcgatttccaaaag-aacaacgcttggccaatgcgcatgcctcca 46929792  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    | |||||||| |||||||||  ||| |||| ||| ||| |||| | |||||||||    
46929791 cacatgagccggattagtcgtccacttttgatggatcgaaaaccgatgcgaaagc 46929737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 70 - 159
Target Start/End: Original strand, 50094925 - 50095014
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| ||| ||||| ||||||| |||||||||||| | |||||||||  |||| || ||||||||||||| ||||| ||||||    
50094925 ggggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgcaaaagcc 50095014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 51437420 - 51437566
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| ||||| ||| || |||||| |||| ||||| ||| |||||| ||||||||||| ||| ||||||||||| ||| ||||||||||||      
51437420 ttgtttgggcttcagtgacaatgagctcctttcaaggacgtatccgaggaatatcgggttcgattcccatggggaacaacgcttgaccagtgcgcatg-- 51437517  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
              |||| ||||||||   ||||||||||||||||||||| |||||||||||    
51437518 ----------agccggattagtcatccacctttggtgggtcggaaaccggtgcgaaagc 51437566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 77 - 157
Target Start/End: Original strand, 50952261 - 50952341
Alignment:
77 aacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||||||||| ||||||||||||||| ||| || ||||||| | |||||||| |||||  |||||||| |||||||    
50952261 aacgattggccagtgtgcatgcctctacgcacgagacaaattagtcacccacctttgatgggttagaaactggcgcgaaag 50952341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 17389727 - 17389881
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||| |||||| |||  ||||  ||||| |||| ||| |||||||| |  ||||||||| | ||| |||||||||||||||| |    
17389727 ttggactccagtggcaaggagctcctttcaatgacgtttccgggaaatatcggattcgattttcg-ggggaacaatgtttgaccagtgcgcatgcctcca 17389825  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||  |||||||||  ||    || |||||||||||| ||||||||||||    
17389826 cgcatgagctggattagtcgtccattgctgatgggtcggaaaccggtgcgaaagcc 17389881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 5 - 119
Target Start/End: Original strand, 31734244 - 31734358
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| |||| ||||||| | ||||||||| | ||||| | ||||||| || ||||||| | | ||| ||||||||||||||||||||||||||||||    
31734244 ttgggcttcagtagcaaggagcaccttccaaggatgtacccgaggaatactggattcgatt-ctaggggaaacaacgattggccagtgcgcatgcctcta 31734342  T
104 cgcatgagccagatta 119  Q
    || | |||||| ||||    
31734343 cgtacgagccaaatta 31734358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 88 - 158
Target Start/End: Original strand, 6899597 - 6899667
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||| ||||||  |||| |||||||||| |||||||| ||| |||||||| |||||||||||    
6899597 agtgcgcatgcctttacgcacaagccggattagtcgcccacctttgatggatcggaaaccggtgcgaaagc 6899667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 45 - 123
Target Start/End: Original strand, 13262079 - 13262157
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcg 123  Q
    |||||||||||||||||||||||| || |||||||| |||| || | |||||| ||||||||| ||| | |||||||||    
13262079 ggggaataccgggttcgatttccagggagaacaacgtttggtcaatacgcatgtctctacgcacgagtcggattagtcg 13262157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 20 - 157
Target Start/End: Original strand, 26258666 - 26258803
Alignment:
20 aaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatt 118  Q
    ||||| ||||||||||  ||||||| |||||||||||| |||||||  || |  || ||||| |||| |||||| ||||||| |||||||||| | ||||    
26258666 aaggagctccttccaaagacgtacccggggaataccggattcgattctcaggaaga-caacgcttggtcagtgcacatgcctttacgcatgagtcggatt 26258764  T
119 agtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    | |||  ||||||| |||||| |||||||||||| ||||    
26258765 aatcgtccacctttagtgggttggaaactggtgcaaaag 26258803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 54 - 152
Target Start/End: Complemental strand, 38859219 - 38859121
Alignment:
54 cgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    ||||||||||| ||| ||| ||||| | |||| || ||| |||||||||||||| ||| ||||||| |||| |||||||| ||||||| |||| |||||    
38859219 cgggttcgattcccaggggtaacaatgtttggtcaatgcacatgcctctacgcacgagtcagattaatcgcccacctttgatgggtcgaaaaccggtgc 38859121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 74 - 123
Target Start/End: Complemental strand, 38791693 - 38791644
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcg 123  Q
    ||||||||||||| ||||||||||||||||||||||||||  ||||||||    
38791693 aacaacgattggcaagtgcgcatgcctctacgcatgagccgaattagtcg 38791644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 5143239 - 5143152
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||| |||| ||||||||||||||||  || | ||||||||||||||||||| ||| ||| |||| |||| |||||||    
5143239 gggaacaacgcttggtcagtacgcatgcctctacgcac-agacggattagtcgctcacctttgatggatcgaaaaccggtgtgaaagcc 5143152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 64
Target Start/End: Original strand, 41743228 - 41743288
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatt 64  Q
    ||||||||| |||||||||| ||||||||||| ||||| ||| ||||||||||||||||||    
41743228 ttgggctccggtggcaaggagctccttccaaggacgtatccgaggaataccgggttcgatt 41743288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 5064000 - 5063866
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| |||||  |||||||| | ||||||||||| ||||| | ||||||||  || ||||||| |  ||||| |||||| |||||||||||| ||| |    
5064000 ttgtttaggctctggtggcaagaagctccttccaaggacgtatctggggaatattggattcgatt-cttaggggcacaacgcttggccagtgcgtatgtc 5063902  T
100 tctacgcatgagccagattagtcgctcacctttggt 135  Q
    |||| ||| ||||  |||||||||| ||||||||||    
5063901 tctatgcacgagctggattagtcgcccacctttggt 5063866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 5 - 123
Target Start/End: Complemental strand, 17988812 - 17988694
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccg-gggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| |||| ||| || ||||||| ||| |||||||  ||||||||| |||| ||||| || ||| ||||| | ||||||||||||||| ||||||    
17988812 ttggactctagtgccaatgagctccttctaaggacgtaccccgggaataccaggtttgattttca-gggaaacaatgcttggccagtgcgcatacctcta 17988714  T
104 cgcatgagccagattagtcg 123  Q
    ||||||| || |||||||||    
17988713 cgcatgaaccggattagtcg 17988694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 74 - 113
Target Start/End: Original strand, 19195391 - 19195430
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagcc 113  Q
    ||||||| ||||||||||||||||||||||||||||||||    
19195391 aacaacgtttggccagtgcgcatgcctctacgcatgagcc 19195430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 159
Target Start/End: Complemental strand, 1764253 - 1764195
Alignment:
101 ctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||||| | |||||||||| |||||||| | |||||||||||| ||||||||||    
1764253 ctacgcatgaggcggattagtcgcccacctttgataggtcggaaactgatgcgaaagcc 1764195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 18808216 - 18808374
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| ||  | |||||||| ||||| |   |||||| | ||||| |||  ||  |||||||||| ||| ||||||||||||||    
18808216 ttgtttgggctccagtggcaatgagtttcttccaaggacgtatctaaggaataacaggttcaattctcagagggaacaacgcttgaccagtgcgcatgcc 18808315  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    | || | ||||||| ||||| |||   | ||||  |||||||||||| |||||||||||    
18808316 tttatgtatgagccggattattcgactaactttattgggtcggaaaccggtgcgaaagc 18808374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 1764346 - 1764277
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaa 69  Q
    ||||||||||| | |||||||||| ||||||||||| ||||| ||||| |||||||| ||||||| ||||    
1764346 ttgtttgggcttctgtggcaaggagctccttccaaggacgtacccgggaaataccggattcgattcccaa 1764277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 49 - 146
Target Start/End: Complemental strand, 42710246 - 42710149
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||| |||||||||||| || ||| |||||   ||||||||||||||||||||||||||| | ||  ||||||||  |||| ||||| | ||||||||    
42710246 aatatcgggttcgattttcaggggaaacaatacttggccagtgcgcatgcctctacgcataaaccgaattagtcgtccaccattggtagatcggaaac 42710149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 123
Target Start/End: Original strand, 13265936 - 13266012
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcg 123  Q
    |||||||| ||||||||| | | ||  |||||||  | ||||||||||||||||||||||||||||| | |||||||    
13265936 ggaatacctggttcgattcctagggaaaacaacgtctagccagtgcgcatgcctctacgcatgagccgggttagtcg 13266012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 25178662 - 25178574
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||| ||||||||||||||| |||||||  |  |||| ||||||||| |||||||| |||||||| |||| | | ||||||||    
25178662 gggaataacgcttggccagtgcgcatacctctacagacaagccggattagtcgttcacctttagtgggtcgaaaaccgatacgaaagcc 25178574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 159
Target Start/End: Complemental strand, 3850799 - 3850740
Alignment:
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||| | |||||||||| |||||||  |||||||||||| ||||||||||||    
3850799 tctacgcacgaggcggattagtcgcccacctttaatgggtcggaaaccggtgcgaaagcc 3850740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 73 - 158
Target Start/End: Complemental strand, 44716299 - 44716214
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||| ||| | ||||||||||||| || ||||||| |||||||||||  ||  |||||||||||| ||| |  |||||||||    
44716299 gaacaacgtttgactagtgcgcatgcctttatgcatgagtcagattagtcgtccatttttggtgggtcgaaaattaatgcgaaagc 44716214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 937642 - 937563
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacg 80  Q
    ||||||||||||||||| ||| || || ||| |||| |||||| || ||||||| |||||||||| ||| |||||||||||    
937642 ttgtttgggctccagtgacaatgagcttctttcaaggacgtactcgaggaatac-gggttcgattcccagggggaacaacg 937563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 2270390 - 2270301
Alignment:
20 aaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgag 111  Q
    ||||| ||| ||||||| ||||| |||| | |||||| ||||||| |  |||||||||| | |||| | |||||||| ||||||||||||||    
2270390 aaggagctcattccaaggacgtatcgggaattaccggattcgattcc--aggggaacaatgtttggtctgtgcgcatacctctacgcatgag 2270301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 102 - 158
Target Start/End: Complemental strand, 47084231 - 47084175
Alignment:
102 tacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| |||||| | | ||| |||||||||| |||||| |||||||||||    
47084231 tacgcatgagccggattagccacccacttttggtgggttggaaaccggtgcgaaagc 47084175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 1766 - 1612
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| ||||||||||| ||||||||||  |||| || |||||||||| ||||||||||||| |||||||||||||| |||||||||||||||||||    
1766 ttggactcaagtggcaaggagctccttccaatgacgtgcctggggaataccaggttcgatttccagggggaacaacgattagccagtgcgcatgcctcta 1667  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| ||||||||| |||||||||||||||| |||| |||||||||||    
1666 cgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc 1612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 95; Significance: 3e-46; HSPs: 4)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 527 - 681
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||  || ||||||||||  |||  ||||| |||||||||||    
527 ttgggctctagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcgcagggggaacaacacttgatcagtgtgcatgcctcta 626  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    || |||||||||||||||||||||||||||||||||||||||| |||||||||||    
627 cgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 8 - 159
Target Start/End: Original strand, 319382 - 319534
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |||||| | ||||||||||| ||||||||||||||| |||||| ||    
319382 ggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggtttgatttctagggggaacaacgcttggccagtgcgcatccctctatgc 319481  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||  |||||||||  ||||||||||||| ||||||| ||||||||||||    
319482 atgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaaagcc 319534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 139397 - 139491
Alignment:
14 agtggcaaggaactccttccaagaacgtacc-----ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||| ||||||||||| ||||||      |||||||| ||||||||||| ||||  ||||||||| ||||||||||| ||||||||||    
139397 agtggcaaggagctccttccaaggacgtacgtatctggggaatatcgggttcgattcccaaaaggaacaacgcttggccagtgcacatgcctcta 139491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 5 - 91
Target Start/End: Complemental strand, 412178 - 412091
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtg 91  Q
    ||||||| ||||||| | || ||||||||||| ||||| ||||||||||||| ||||||||  || ||||||||||| |||| |||||    
412178 ttgggcttcagtggcgatgagctccttccaaggacgtatccggggaataccgagttcgattcacagggggaacaacgcttggtcagtg 412091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 93; Significance: 4e-45; HSPs: 66)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 5 - 156
Target Start/End: Complemental strand, 15884707 - 15884556
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||| ||||| ||||||||||| ||||||| |||||||||||||||||||| ||| ||||||||||  ||||| ||||||||||||||||    
15884707 ttgggctccagtggtaaggagctccttccaaggacgtacctggggaataccgggttcgattccca-ggggaacaacacttggcaagtgcgcatgcctcta 15884609  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||| ||||| |||||||||| ||||||||||||||||||||| |||||||||    
15884608 cgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 2467270 - 2467115
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||  |||||||||||||||| |||||    
2467270 ttgggctccagtggcaaggagctccttccaaggacgtatccggggaataccgggttcgatttccagggggaacaactcttggccagtgcgcatgtctcta 2467171  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||||||| |||||||||  |||  |||||| ||||||||| ||||||||||||    
2467170 tgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaaagcc 2467115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 6100426 - 6100585
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||| |||||||||||| |||||| |||| ||||| |||||||||||||||||||||| ||| | ||||||||| ||||||||||||||||||    
6100426 ttgtttgggcttcagtggcaaggagctcctttcaaggacgtatccggggaataccgggttcgattcccaggaggaacaacgcttggccagtgcgcatgcc 6100525  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||||||||||||| ||||||||| |||||||| |||||||| |||| | ||||||||||    
6100526 actacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccgctgcgaaagcc 6100585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 44893434 - 44893277
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| ||||| | ||||||||| | |||||||||| |||||||    
44893434 ttgtttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcaatttctagggggaacaatgcttggccagtgtgcatgcc 44893335  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||| ||||| ||||||||| ||| |||||||||||| ||||| ||||    
44893334 tctacgcacgagccggattaatcgctcacccttgatgggtcggaaaccggtgcaaaag 44893277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 10927564 - 10927719
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||| |||||||||||| || ||| |||| ||||||| |||||||||||||||||||| | | | ||||||||| ||||||||||||||||||||||    
10927564 ttgggcttcagtggcaaggagcttctttcaaggacgtacccggggaataccgggttcgattcctaggaggaacaacgcttggccagtgcgcatgcctcta 10927663  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| ||||||||| |||||||| ||||||||||||| | ||||||||||    
10927664 cgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagcc 10927719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 14666223 - 14666068
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||| ||||||| ||||| |||||||||||||||||||||| ||| ||| ||||||  ||||||||||||||||||||||    
14666223 ttgggctccagtggcaaggagctcattccaaggacgtatccggggaataccgggttcgattcccaggggaaacaacacttggccagtgcgcatgcctcta 14666124  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||  ||||||||||||||| |||  ||||||||||| |||| ||||||||||||    
14666123 cgcacaagccagattagtcgcccacagttggtgggtcgaaaaccggtgcgaaagcc 14666068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 8141056 - 8141214
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| || |||||||| |||||  ||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||    
8141056 ttgtttgggctccagtggcaaggagctgcttccaaggacgtattcggggaataccgggttcgatttccaggggaaacaacgcttggccagtgcgcatgcc 8141155  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||   ||||||||  ||| ||||||||||| ||||| | |||||||||    
8141156 tctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaagc 8141214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 8997696 - 8997542
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||||||||||||||||||| |||| || ||  |||||||||||| |||||||| | ||||||||||||| || |||||| ||||||||| ||    
8997696 ttggactccagtggcaaggaactcctttcaaggacatattcggggaataccgtgttcgattcctaaggggaacaacgtttcgccagttcgcatgcctata 8997597  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||| ||| |||||||||||||||||| |||||||||||    
8997596 cgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaagc 8997542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 45521127 - 45521280
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||  || ||||||| | ||||| |||||||||||||||||||| ||| ||||||||||  |||  |||||||||||||||||    
45521127 ttgggctccagtggcaaggagttcattccaaggatgtacccggggaataccgggttcgattccca-ggggaacaacacttgatcagtgcgcatgcctcta 45521225  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| ||||||||||||||||||| |||||||||||| |||||||||||    
45521226 cgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaagc 45521280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 14846530 - 14846688
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||| | ||||||| ||| ||||||| ||||||||||||||||||||  || ||||||||| |||||| |||||||||||||    
14846530 ttgtttgggctccactggcaagaagctccttctaaggacgtacccggggaataccgggttcgattctca-ggggaacaatgattggtcagtgcgcatgcc 14846628  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||| ||||| |||||  ||||||||||||||||||||  ||||||||||||    
14846629 tctacgcatgagtcagataagtcgtccacctttggtgggtcggaaatcggtgcgaaagcc 14846688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 24837200 - 24837355
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| ||||||||||| |||||||| ||| || |||||||| ||||||||||  ||||||||||    
24837200 ttgggctccagtggcaaggagctccttccaagtacgtacccggggaataccgtgttcgattcccagggagaacaacgcttggccagtgttcatgcctcta 24837299  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
     ||| ||||  |||||||||  |||||||||||| |||||||||||||||||||||    
24837300 agcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaagcc 24837355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 43032855 - 43033013
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||||||  ||||||||| || ||| | ||||| || ||| ||||||| ||| ||||||||||| ||||||||||||||||||    
43032855 ttgtttgggctccagtggcaaggagttccttccaaaaatgtatctgggaaatatcggattcgattcccagggggaacaacgcttggccagtgcgcatgcc 43032954  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||| || ||||| |||||||||| ||||||||||||||| ||||| |||||||||||    
43032955 tctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 43033013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 33401955 - 33401818
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||||| |||| |||||| |||||||||||||||||||||| || ||||||||||  ||| |||||| |||||||    
33401955 ttgtttgggctccagtggcaaggagctcctttcaaggacgtactcggggaataccgggttcgattttcagggggaacaacacttgaccagtgtgcatgcc 33401856  T
100 tctacgcatgagccagattagtcgctcacctttggtgg 137  Q
    |||||||||||| | |||||||||| ||||||| ||||    
33401855 tctacgcatgagtcggattagtcgcccacctttagtgg 33401818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 9860152 - 9860005
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc--ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgc 98  Q
    ||||||||| ||||||||||| || ||||||||||| ||||| |  |||||||||||||||||||| ||| ||||||||||  |||||||||| ||||||    
9860152 ttgtttgggatccagtggcaaagagctccttccaaggacgtatccgggggaataccgggttcgattcccagggggaacaacacttggccagtgtgcatgc 9860053  T
99 ctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| ||||||||||||||||||  |||| ||||||| ||||||||    
9860052 ctctacacatgagccagattagtcgtccaccattggtggatcggaaac 9860005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 2964034 - 2964189
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| ||||||||| | ||||||||||||||||||| ||||||||||| |||||||| | | | ||||||||| ||||||| || |||||||||||    
2964034 ttggactctagtggcaagtagctccttccaagaacgtacccggggaataccgtgttcgattccgatgaggaacaacgcttggccaatgtgcatgcctcta 2964133  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||| || || |||||||||| ||||||||||||||| ||||| ||||||||||||    
2964134 cgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagcc 2964189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 3418669 - 3418511
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| |||| |||||||||| ||||||||||| ||||| | |||||||| ||||||||||||  | | ||||||||  |||||||||||||||||     
3418669 ttgtttggactcccgtggcaaggagctccttccaaggacgtatctggggaatatcgggttcgatttttaggaggaacaacacttggccagtgcgcatgcg 3418570  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||| |||||||||||  ||||||| ||||||| ||||| |||||||||||    
3418569 tctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcgaaagc 3418511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 43027259 - 43027417
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||| || ||||||||||   ||||||||| |||||||||| ||| | ||||||||||||| ||| ||||||||||    
43027259 ttgtttgggctccagtggcaatgagctcatttcaagaacgtatttggggaatactgggttcgattcccaggaggaacaacgattgtccaatgcgcatgcc 43027358  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||| |||||||||  || ||||| |||||||||||| | |||||||||    
43027359 tctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaagc 43027417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 4479451 - 4479296
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||| | |||||||||| |  ||||| |||| ||||||| |  ||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||    
4479451 ttgtttgggtttcagtggcaagaagttcctttcaaggacgtacctgtagaataccggattcgattccca-ggggaacaacgcttggccagtgcgcatgcc 4479353  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    |||||||||||||  |||||||||  ||||||||||||||||||||| |||||||||    
4479352 tctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 4479296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 10535559 - 10535401
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||||||| ||||| ||| |||||||  ||||| |||| || |||||||| || ||| |||||||||||| |    
10535559 ttgtttggactccagtggcaaggagctccttccaaggacgtatccgaggaatacatggttcaattttca-ggggaacaccgcttgaccagtgcgcatgtc 10535461  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    || |||||||||||  |||||||| |||||||||||  ||||||||||||||||||||||    
10535460 tccacgcatgagccgaattagtcgttcacctttggtaagtcggaaactggtgcgaaagcc 10535401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 6 - 152
Target Start/End: Original strand, 11785876 - 11786021
Alignment:
6 tgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    |||||||||||| |||||| ||| ||||||| ||||||| |||||||||||| ||||||| ||||||||| ||||| |||| ||||| ||||||||||||    
11785876 tgggctccagtg-caaggagctcattccaaggacgtacccggggaataccggattcgatt-ccaaggggagcaacgtttgggcagtgtgcatgcctctac 11785973  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    ||||||||||||||| ||||||| ||||| ||| |||||||| |||||    
11785974 gcatgagccagattaatcgctcatctttgatggatcggaaaccggtgc 11786021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 146
Target Start/End: Complemental strand, 1013129 - 1012987
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||  ||||||| ||||| |||||||||||||||||||||| ||| ||||||||||| ||||||||| | ||||||||||    
1013129 ttgggctccagtggcaaggagctttttccaaggacgtatccggggaataccgggttcgattcccagggggaacaacgcttggccagtacacatgcctcta 1013030  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||  |||| ||| |||||||| |||| ||| ||||    
1013029 cgcatgagccgaattaatcgttcacctttagtggatcgaaaac 1012987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 158
Target Start/End: Original strand, 17981399 - 17981553
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| | ||||| ||||| |||||||||||||| ||| ||||||||||  ||| |||||| |||||||||||    
17981399 ttgggctccagtggcaaggagctccttccaaggatgtacccgggaaataccgggttcgattcccagggggaacaactcttgaccagtgtgcatgcctcta 17981498  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| ||| |  |||||| || || |||||||| ||||||||| |||||||||||    
17981499 cgcacgagtcgaattagttgcccagctttggtgagtcggaaaccggtgcgaaagc 17981553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 34846768 - 34846886
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcct 100  Q
    |||||||||||||||||||||||| ||| ||||||| ||||||| ||||||||||||||||||| ||| || |||||||| |||||||||  ||||||||    
34846768 ttgtttgggctccagtggcaaggagctcattccaaggacgtacccgggaataccgggttcgattcccatggtgaacaacgcttggccagtatgcatgcct 34846867  T
101 ctacgcatgagccagatta 119  Q
    |||||||  ||||||||||    
34846868 ctacgcacaagccagatta 34846886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 5 - 114
Target Start/End: Complemental strand, 38922566 - 38922456
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||| |||  |||||||||| ||||||||||||||||||| ||    
38922566 ttgggctccagtggcaaggagctccttccaaggacgtacccggggaataccgggttcgattcccagagggaacaacgcttggccagtgcgcatgccttta 38922467  T
104 cgcatgagcca 114  Q
    |||| ||||||    
38922466 cgcacgagcca 38922456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 583768 - 583925
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| || |||||||| |||||| || | |||||||||||||||| | |  |||||||||| ||| ||||||||||||||    
583768 ttgtttgggctctagtggcaaggagctacttccaaggacgtactcgagaaataccgggttcgattccta--gggaacaacgcttgaccagtgcgcatgcc 583865  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||| | |||||||||| |||||||| ||| |  ||||| ||||||||||||    
583866 tctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagcc 583925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 5 - 159
Target Start/End: Original strand, 16893895 - 16894048
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||  ||||||||||||||||||||||  ||||| |||||||||| |||||||||||  || |||||| |||| ||||||||| | ||||||| ||    
16893895 ttgggctatagtggcaaggaactccttccaatgacgtatccggggaatatcgggttcgattcacagggggaataacgcttggccagtacacatgccttta 16893994  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||| ||||| |||||||||| |||||||||| ||||||||||||    
16893995 cgcatgagccggatt-gtcgcccacctttggt-ggtcggaaaccggtgcgaaagcc 16894048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 43 - 140
Target Start/End: Original strand, 6042818 - 6042915
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtc 140  Q
    |||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||  ||||||||||| |||||||||| ||||  |||||||||    
6042818 ccggggaataccgggttcgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggattagtcgcccaccactggtgggtc 6042915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 13085478 - 13085602
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||| |||| ||||||||||| ||||| ||||||||||||||||||||||  ||  |||||||||| || ||||||| |||| ||    
13085478 ttgtttgggctccagtggcgaggagctccttccaaggacgtatccggggaataccgggttcgattctcagagggaacaacgtttagccagtgtgcatacc 13085577  T
100 tctacgcatgagccagattagtcgc 124  Q
    |||||||| ||||||||||| ||||    
13085578 tctacgcacgagccagattaatcgc 13085602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 18373964 - 18374121
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||| ||||||||| ||| ||||||  |  || ||||| |||||| |||||||||  || || |||||||| ||| ||||||||||||||    
18373964 ttgtttgggctccaatggcaaggagctcattccaaagatatatccgggaaataccaggttcgattctcagggagaacaacgcttgaccagtgcgcatgcc 18374063  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||| |||||||||  || ||||||||||||| |||| ||||| ||||    
18374064 tctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgcaaaag 18374121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 71 - 159
Target Start/End: Complemental strand, 11298352 - 11298264
Alignment:
71 gggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||  || ||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||| ||||||||||||    
11298352 gggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaagcc 11298264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 68254 - 68097
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||| ||||| |||||||||| ||||||||||| |||| | ||||||| | |||||||||||  || | ||||||||| |||||||||  |||||||    
68254 ttgtttgagctccggtggcaaggagctccttccaaggacgtgctcggggaagatcgggttcgattctcaggaggaacaacgtttggccagtatgcatgcc 68155  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    | ||| || ||||| ||||| ||| ||||||||| |||||||||||| ||||| ||||    
68154 tttacacacgagccggattaatcgttcacctttgatgggtcggaaaccggtgcaaaag 68097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 56 - 158
Target Start/End: Complemental strand, 16291303 - 16291201
Alignment:
56 ggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaa 155  Q
    |||||||||| || ||||||||||  ||||||||| | |||||||||| ||||||||  ||||||||||||||||||||||||||| |||| |||| |||    
16291303 ggttcgattttcagggggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaa 16291204  T
156 agc 158  Q
    |||    
16291203 agc 16291201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 34613934 - 34613821
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || |||||||||| | |||| |||||||||| ||||||||||| ||| | |||||||||  |||||||| ||||||||    
34613934 ttgtttgggctccagtggcaatgagctccttccaaaaccgtatccggggaatatcgggttcgattcccaggaggaacaacgtctggccagtacgcatgcc 34613835  T
100 tctacgcatgagcc 113  Q
    ||||  ||||||||    
34613834 tctatacatgagcc 34613821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 44031596 - 44031467
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggcc-----agtgcgc 94  Q
    ||||||| |||| ||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||||| ||||||||||| ||||||     |||| ||    
44031596 ttgtttgagctctagtggcaaggaactccttccaaggatgtaaccgggaaatatcgggttcgatttccagggggaacaacgcttggccagtgtagtgtgc 44031497  T
95 atgcctctacgcatgagccagattagtcgc 124  Q
    |||||||| |||| ||||| ||||||||||    
44031496 atgcctctgcgcacgagccggattagtcgc 44031467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 271 - 423
Target Start/End: Complemental strand, 7978615 - 7978452
Alignment:
271 atgaaagaataatttttggatcaatagatgaatgaatgtaatgttaattatatgaaacaatacattaacaaaataatcatatggaaaggaa--------- 361  Q
    ||||||||||| | |||||||||||| ||||||||||||| ||||||| |||||||||| ||||   |||||||||||| |  ||||||||             
7978615 atgaaagaatattctttggatcaatacatgaatgaatgtactgttaatcatatgaaacattaca---acaaaataatcacagtgaaaggaagcttgaaaa 7978519  T
362 --actagttattatgatcatctttggttata---ttgtttttggccctcattctactaccccatgat 423  Q
      ||||||||||||||||||||||| | |||   |||||||||||||||||||| ||||||||||||    
7978518 aaactagttattatgatcatctttgttgatagtattgtttttggccctcattctcctaccccatgat 7978452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 22810034 - 22810154
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||||||||||| ||||| |||| ||| | ||||||||| ||||  ||||||||||| |||| |||||||||||      
22810034 ttgtttgggctctagtggcaaggagctccttccaaggacgtatccggagaacatcgggttcga-ttccctggggaacaacgcttggtcagtgcgcatg-- 22810130  T
100 tctacgcatgagccagattagtcg 123  Q
    ||| ||||||||||||||||||||    
22810131 tcttcgcatgagccagattagtcg 22810154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 29933727 - 29933870
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||| ||||||||||||||| ||||||| ||||| ||| |||| |||||| |||||||||| ||| || |||||||  ||| ||||||  ||||||    
29933727 ttgtttggactccagtggcaaggagctccttctaagaatgtatccggagaatac-gggttcgattcccagggagaacaacacttgaccagtgtacatgcc 29933825  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||| ||||||| |||||||||| | |||||| || |||||||    
29933826 tctacgtatgagccggattagtcgcacccctttgatgagtcggaa 29933870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 24938718 - 24938572
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| |||| |||||| || |||| || ||||||| ||||||||||| |   | ||||||  |||| || ||||||||||    
24938718 ttgtttgggctccagtggcaaggagctccctccaaggacatacccggagaataccaggttcgatttctagatgaaacaacacttggtcaatgcgcatgcc 24938619  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||| || ||||||||   |||||||| ||| ||||||||    
24938618 tctacgcatgaaccggattagtcatccacctttgatggatcggaaac 24938572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 33935891 - 33935761
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||| ||||||| ||||||  ||| | |||||   |||||||||| ||||||| | | || |||||||  ||||||||||||||||||    
33935891 ttgtttgggctccagttgcaaggagctccttttaaggatgtacccaaggaataccggattcgattcctagggagaacaacacttggccagtgcgcatgcc 33935792  T
100 tctacgcatgagccagattagtcgctcacct 130  Q
    | |||||||||| | ||||||||||||||||    
33935791 tatacgcatgagtcggattagtcgctcacct 33935761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 8 - 156
Target Start/End: Complemental strand, 7673803 - 7673657
Alignment:
8 ggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgc 106  Q
    ||||||||||||||||| ||||||||||| ||||| | |||||||| |  ||||||||   | ||||||||||| ||||| |||| ||||||||||||||    
7673803 ggctccagtggcaaggagctccttccaaggacgtatctggggaatatcaagttcgatt---agggggaacaacgtttggctagtgtgcatgcctctacgc 7673707  T
107 atgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    | ||||| ||||  |||| || |||| |||| ||| |||| |||||||||    
7673706 acgagccggatttttcgcccatctttagtggatcgaaaaccggtgcgaaa 7673657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 26570878 - 26571037
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| |  |||  ||| | ||| | ||||| || ||||||| ||| | | ||||||||||| |||||||||| | ||||     
26570878 ttgtttgggctctagtggcaaggagcgacttttaaggatgtatctgggaaatatcgggttcaattcctagggggaacaacgcttggccagtgtgtatgca 26570977  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||||| |||||||||  |||||||| || ||||||||| | || |||||||    
26570978 tctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccgatgtgaaagcc 26571037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 6940512 - 6940657
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||| ||||| ||| ||||||| | ||| ||||  |||| ||||||||||||||| | ||||||||| ||||| |||||||||  |    
6940512 ttgtttgggctccagtggtaaggagctcattccaaggaggtatccggaaaatatcgggttcgatttccaggtggaacaacgcttggctagtgcgcat-ac 6940610  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    | ||| |||||| |  |||||||   |||||||||||||| ||||||    
6940611 tttacacatgagtcgaattagtcatccacctttggtgggtaggaaac 6940657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 38235863 - 38236005
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||||||||||||||||| |||||||| ||||||| ||||| |||||| ||||||| |||  |  ||||| | ||||||| ||| ||||  ||||    
38235863 ttgggctccagtggcaaggaacttcttccaaggacgtacctgggaagtaccggattcgattcccagagaaaacaatgcttggccattgcacatgattcta 38235962  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
     ||| ||||  |||||||||| |||  ||||||||| ||||||    
38235963 tgcacgagcgggattagtcgcccactgttggtgggttggaaac 38236005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 17845687 - 17845841
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||||||||||| || ||||||||||| | |||| ||||||||| | |||| || |||| |||||||||||  ||||| ||||| ||| ||    
17845687 ttgtttgggctccagtggcaatgagctccttccaaggatgtactcggggaata-ctggtttga-ttcccaggggaacaacacttggctagtgcacattcc 17845784  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||||  ||    |||| |||| |||| |||||||||||||||| ||||||||||    
17845785 tctacgcacaagtttaattaatcgcccacc-ttggtgggtcggaaaccggtgcgaaag 17845841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 86 - 159
Target Start/End: Complemental strand, 22212585 - 22212512
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| ||||||| |||||||| | ||| ||||||||||||||||||||||| ||| |||| ||||||||||||    
22212585 ccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaagcc 22212512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 70 - 146
Target Start/End: Original strand, 3567928 - 3568004
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||  ||| ||||||| ||| ||||||||||||||||| |||||||   |||||||||||||||||||||    
3567928 ggggaacaacacttgaccagtgcacatacctctacgcatgagccaaattagtcatccacctttggtgggtcggaaac 3568004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 73 - 157
Target Start/End: Original strand, 23895595 - 23895679
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||| ||||||||||||||| |||||||||| |||   ||||| |||  |||||||| |||||||||||| ||||||||||    
23895595 gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag 23895679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 70 - 152
Target Start/End: Complemental strand, 13358042 - 13357960
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgc 152  Q
    ||||||||||| ||||||| || ||||||||||| ||| ||||| |||||||||  | ||||| ||||||||||||| |||||    
13358042 ggggaacaacgtttggccaatgtgcatgcctctatgcacgagccggattagtcgtccccctttagtgggtcggaaaccggtgc 13357960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 77 - 158
Target Start/End: Original strand, 3692864 - 3692945
Alignment:
77 aacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||| |||||||||| ||||||||||||||||  |||| ||| ||||||||||| ||||| |||| ||| |||||||    
3692864 aacgtttggtcagtgcgcatacctctacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggtacgaaagc 3692945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 5 - 150
Target Start/End: Complemental strand, 35496406 - 35496261
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    ||||||||| |||||||||| ||| || |||| ||||| || |||||| | ||||| |||| ||  || ||||||  |||| ||||||||||||||||||    
35496406 ttgggctccggtggcaaggagctcatttcaaggacgtatcgaggaatatcaggttcaattttcagaggaaacaacacttggtcagtgcgcatgcctctac 35496307  T
105 gcatgagccagattagtcgctcacctttggtgggtcggaaactggt 150  Q
    | | ||||  ||||| |||| |||||||| ||| ||| ||| ||||    
35496306 gtacgagctggattaatcgcccacctttgatggatcgaaaattggt 35496261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 145
Target Start/End: Complemental strand, 43349423 - 43349327
Alignment:
49 aataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaa 145  Q
    |||| ||| ||| ||||| | ||||||||||| || |||||||  ||| ||||||| || ||||| ||||||||||||||| ||| |||||||||||    
43349423 aatatcggattcaatttctagggggaacaacgctttgccagtgttcatacctctactcacgagccggattagtcgctcacccttgatgggtcggaaa 43349327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 82 - 157
Target Start/End: Original strand, 2209819 - 2209894
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||||||||| | |||||||| ||   ||||||||||||||| ||||| |||| ||||||||||||||||    
2209819 ttggtcagtgcgcatgtccctacgcataagttggattagtcgctcaccattggtaggtcagaaactggtgcgaaag 2209894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 70 - 113
Target Start/End: Complemental strand, 8587025 - 8586982
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagcc 113  Q
    ||||||||||| ||||||||||||||| ||||||||||||||||    
8587025 ggggaacaacgcttggccagtgcgcatacctctacgcatgagcc 8586982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 47 - 157
Target Start/End: Original strand, 36662406 - 36662515
Alignment:
47 ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||| |||||||||||| || |||||||||   || ||||||||||||||||||||| |||| || |||||||||  ||| |||  ||| ||||||||    
36662406 ggaatatcgggttcgattttca-ggggaacaatacttagccagtgcgcatgcctctacgtatgaaccggattagtcgtccacttttaatggatcggaaac 36662504  T
147 tggtgcgaaag 157  Q
     | ||||||||    
36662505 cgatgcgaaag 36662515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 88 - 158
Target Start/End: Complemental strand, 39969983 - 39969913
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||||||| |||||| |||||||||||| || | ||| ||| |||||||| | |||||||||    
39969983 agtgcgcatgcctctacacatgagtcagattagtcgcccatcattgatggatcggaaaccgatgcgaaagc 39969913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 87 - 156
Target Start/End: Complemental strand, 3379881 - 3379812
Alignment:
87 cagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||| ||||||| ||||||| | |||||||||  ||| ||||||||||||||||  |||||||||    
3379881 cagtgcgcacgcctctatgcatgagtcggattagtcgtccacttttggtgggtcggaaatcggtgcgaaa 3379812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 30903290 - 30903422
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||| |||||||| | ||||| || |||||||  |||||  ||||||||||||| |||||||| || ||| ||||| | ||| ||||||||||||||    
30903290 ttgtttgcgctccagtagtaaggagcttcttccaatgacgtattcggggaataccggattcgattttca-gggaaacaatgcttgaccagtgcgcatgcc 30903388  T
100 tctacgcatgagccagattagtcgctcacctttg 133  Q
     |||| ||  || ||||||| |||||| ||||||    
30903389 gctacacacaagtcagattaatcgctcgcctttg 30903422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 86 - 146
Target Start/End: Original strand, 12754065 - 12754125
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||||||||||||| |||  || ||||||||||||||| ||||| ||| ||||||||    
12754065 ccagtgcgcatgcctctatgcacaagtcagattagtcgctcatctttgatggatcggaaac 12754125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 87 - 159
Target Start/End: Original strand, 27975932 - 27976004
Alignment:
87 cagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||||||||| |||||| ||||| |||| ||||||| ||||||| | ||| | ||||||||||    
27975932 cagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 27976004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 87 - 159
Target Start/End: Original strand, 28033201 - 28033273
Alignment:
87 cagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||| |||||||||||||| |||||| ||||| |||| ||||||| ||||||| | ||| | ||||||||||    
28033201 cagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagcc 28033273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 34710723 - 34710623
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    ||||||||||||| |||||||| |  | |||||||| |||||| |||  |||||||| ||||||| ||| ||| ||||||  ||||| ||||||||||||    
34710723 ttgtttgggctccggtggcaagaagtttcttccaaggacgtactcggaaaataccggattcgattcccaggggaaacaacacttggctagtgcgcatgcc 34710624  T
100 t 100  Q
    |    
34710623 t 34710623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 88 - 159
Target Start/End: Original strand, 8803096 - 8803167
Alignment:
88 agtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    ||||||||  |||||||||| ||||| |||||||||| || |  ||||||||||||||| | ||||||||||    
8803096 agtgcgcagacctctacgcacgagccggattagtcgcccatcaatggtgggtcggaaaccgatgcgaaagcc 8803167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 74 - 131
Target Start/End: Original strand, 18091428 - 18091485
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctt 131  Q
    ||||||| ||| |||||||||||||||||||||| ||| |  ||||||||| ||||||    
18091428 aacaacgtttgaccagtgcgcatgcctctacgcacgaggcgaattagtcgcccacctt 18091485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 87 - 156
Target Start/End: Complemental strand, 28738220 - 28738151
Alignment:
87 cagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||||| || |||||| ||||||||| ||| || |||| |||||  ||||||||| |||||||||    
28738220 cagtgcgcatgtctttacgcacgagccagatcagttgcccaccattggtatgtcggaaaccggtgcgaaa 28738151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 73 - 121
Target Start/End: Original strand, 21174167 - 21174215
Alignment:
73 gaacaacgattggccagtgcgcatgcctctacgcatgagccagattagt 121  Q
    |||||||| |||| ||||||||||| |||||||||| |||| |||||||    
21174167 gaacaacgcttggtcagtgcgcatggctctacgcatcagccggattagt 21174215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 98 - 158
Target Start/End: Original strand, 34593615 - 34593675
Alignment:
98 cctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||| |||||| |||| || |||| ||||||||||||  |||| |||||||||||    
34593615 cctctacgcacgagccaaattactctctcatctttggtgggtcaaaaaccggtgcgaaagc 34593675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 92; Significance: 2e-44; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 43 - 158
Target Start/End: Original strand, 6851 - 6966
Alignment:
43 ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcgg 142  Q
    |||||||||||||||||||||| ||| ||||||||||  |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
6851 ccggggaataccgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcgg 6950  T
143 aaactggtgcgaaagc 158  Q
    |||| |||||||||||    
6951 aaaccggtgcgaaagc 6966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 8866 - 8699
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg----------ggaataccgggttcgatttccaaggggaacaacgattggccagt 90  Q
    |||||||||||||||||||||||| ||||||||||| ||||| | |          |||||||||||||||||| ||| ||||||||||| |||||||||    
8866 ttgtttgggctccagtggcaaggagctccttccaaggacgtatcagacgtatcagaggaataccgggttcgattcccagggggaacaacgcttggccagt 8767  T
91 gcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||| |||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||||    
8766 gcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 8699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 68470 - 68626
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccggggaa-taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| ||||||||||| ||||||| ||||| || ||||||||||| ||| ||||||||||| ||||   |||||||||||    
68470 ttgtttgggctctagtggcaaggagctccttccaaggacgtacccgggaaatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcc 68566  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| |||||||||||||||| |||| ||||||| ||||    
68567 tctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgatagcc 68626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 40997 - 41156
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||||||||||| ||||||||| | |||||| | ||||||| |||||||||||  |||||||||||||  |||| ||||| |||||||    
40997 ttgtttgggctccagtggcaaggagctccttccatggacgtactcagggaatatcgggttcgattctcaaggggaacaacacttggtcagtgtgcatgcc 41096  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| ||||| |||||||||| || |||||||| ||||||||| ||| ||||||||    
41097 tctacgcacgagccggattagtcgcccatctttggtgagtcggaaaccggttcgaaagcc 41156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 78; Significance: 4e-36; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 5 - 157
Target Start/End: Complemental strand, 42984 - 42831
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| |||||||||||| || || |||||||||| ||||| |||||||| ||||||||||| | | || |||||| | |||| |||||||||||||||||    
42984 ttggactccagtggcaacgagctacttccaagaatgtacctggggaatatcgggttcgattcctagggagaacaatgcttggtcagtgcgcatgcctcta 42885  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    | |||||||| |||||||||| ||||||||||||||||||||| ||||||||||    
42884 cacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 9393 - 9551
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc---- 99  Q
    ||||||||| ||  |||||| |||||| |||| ||||||  |||||||||||||||||||| ||| ||||||||||| |||||||||  | |||||        
9393 ttgggctccggtaacaaggagctcctttcaaggacgtacttggggaataccgggttcgattcccagggggaacaacgcttggccagtaag-atgcctcta 9491  T
100 ---tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
       ||||||||||||||| ||||||||  ||||||||||||||| ||||| |||||||||    
9492 agttctacgcatgagccaaattagtcgtccacctttggtgggtcagaaaccggtgcgaaa 9551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 9798 - 9944
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtaccgg-ggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||| | |||||||| |||||| ||||||||||| | ||| | | |||||||||| ||||||||||| ||||||||||| ||||||||||||||||||    
9798 ttgttttgactccagtgacaaggagctccttccaaggatgtatctgaggaataccggattcgatttccagggggaacaacgcttggccagtgcgcatgcc 9897  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||| ||||| |||||||||  ||||||||||||||| |||||    
9898 tctacgcacgagccggattagtcgtccacctttggtgggtcagaaac 9944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 74; Significance: 9e-34; HSPs: 2)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 5 - 159
Target Start/End: Complemental strand, 95131 - 94977
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgta-ccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||||||||| ||||||||| ||||||||||||| ||| |||||||||||| ||||||||||| |  || ||||||| ||| ||||||||||||||| ||    
95131 ttgggctccaatggcaaggagctccttccaagaaagtatccggggaataccaggttcgatttcta--ggaaacaacgtttgaccagtgcgcatgccttta 95034  T
104 cgcatgagccagattagtcgctcacc-tttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||| |||||||||| |||| ||||||||||||||||  ||||| ||||||    
95033 cgcatgagccggattagtcgcccaccatttggtgggtcggaaatcggtgcaaaagcc 94977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 31 - 159
Target Start/End: Complemental strand, 7961 - 7832
Alignment:
31 tccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacc 129  Q
    |||||| ||||||| ||||||||||||||| |||| |||||||||| |||  ||||||||||||||||||||||||||| |||  |||||||||| ||||    
7961 tccaaggacgtacccggggaataccgggtttgattcccaaggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccacc 7862  T
130 tttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||| |||||||| ||| ||||||||    
7861 tttggtggatcggaaaccggtacgaaagcc 7832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 69; Significance: 8e-31; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 1 - 159
Target Start/End: Original strand, 12528 - 12685
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||| ||||||||||| || |||||||| |||||| || | |||||||||||||||| | |  |||||||||| ||| ||||||||||||||    
12528 ttgtttgggctctagtggcaaggagctacttccaaggacgtactcgagaaataccgggttcgattccta--gggaacaacgcttgaccagtgcgcatgcc 12625  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagcc 159  Q
    |||||||||||| | |||||||||| |||||||| ||| |  ||||| ||||||||||||    
12626 tctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagcc 12685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 69; Significance: 8e-31; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 25940 - 25784
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtac-cggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcc 99  Q
    |||||||||||||||| |||| || ||||||||||| |||||| ||||||||||  ||||||||| | | || |||||||| |||||||||||||||| |    
25940 ttgtttgggctccagtagcaaagagctccttccaagtacgtactcggggaatacaaggttcgattcctagggagaacaacgcttggccagtgcgcatgac 25841  T
100 tctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||| ||| ||||||||||| | |||||||  |||||| ||||| |||||||||    
25840 tctacgcgtgaaccagattagtcacccacctttactgggtcagaaaccggtgcgaaa 25784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 58 - 159
Target Start/End: Complemental strand, 155809 - 155708
Alignment:
58 ttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| ||| ||||||||||| ||||| |||||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| | ||||||||||    
155809 ttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaag 155710  T
158 cc 159  Q
    ||    
155709 cc 155708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 12627 - 12780
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| ||||||||| | ||||||||||| |||| || ||||||||||||||||||||   | | ||||||||| |||||||||| |||||||||||    
12627 ttggactctagtggcaagaagctccttccaaggacgtgcccggggaataccgggttcgattcagaggaggaacaacgcttggccagtgtgcatgcctcta 12726  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| || || |||||||||| |||||||| |||||| ||||| ||||||||||    
12727 cgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 5 - 157
Target Start/End: Original strand, 26140 - 26293
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||| ||||||||| ||||||||| ||| || |||| ||||||||| |||||||||||||| ||||||||||| |||||||||| |||||||||||    
26140 ttggactctagtggcaagaaactccttctaaggacatacctggggaatactgggttcgatttccagggggaacaacgcttggccagtgtgcatgcctcta 26239  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||| ||||| |||||||||  |||  ||| || |||||||||  |||||||||    
26240 cgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaaag 26293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 66; Significance: 5e-29; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 72604 - 72709
Alignment:
19 caaggaactccttccaagaacgtaccggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagatt 118  Q
    |||||| ||||||||||| ||||| | ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| | |||| |||| ||||    
72604 caaggagctccttccaaggacgtatcagggaataccgggttcgatttccaaggggaacaacgcttgaccagtgcgcatgcctcaaagcataagccggatt 72703  T
119 agtcgc 124  Q
    ||||||    
72704 agtcgc 72709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 5 - 146
Target Start/End: Original strand, 5930 - 6071
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||| || ||||||||||| |||||| ||||  |||||| ||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||||||||    
5930 ttgggttctagtggcaaggagctcctttcaagggcgtacccggggaatactgggttcgatttccaggggga-caacgcttggccagtgcacatgcctcta 6028  T
104 cgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    |||||||| |  ||||||||  |||| ||||||||||||||||    
6029 cgcatgagacgaattagtcgtccaccattggtgggtcggaaac 6071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 57; Significance: 1e-23; HSPs: 4)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 271226 - 271106
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    ||||||||  |||||||||| ||||||||||| ||||||| || ||||| ||||||||||| ||| ||||||||||| |||| ||||||||||| |||||    
271226 ttgggctctggtggcaaggagctccttccaaggacgtacccggagaatatcgggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctcta 271127  T
104 cgcatgagccagattagtcgc 124  Q
    |||| ||||| | ||||||||    
271126 cgcacgagccgggttagtcgc 271106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 82 - 157
Target Start/End: Complemental strand, 250099 - 250024
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||  ||||||||||    
250099 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 250024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 82 - 158
Target Start/End: Original strand, 219404 - 219480
Alignment:
82 ttggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    |||||||||||||||||||||||||| || |  |||||||||  |||||||| ||| ||| |||| ||||| |||||    
219404 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 219480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 45 - 159
Target Start/End: Complemental strand, 249416 - 249308
Alignment:
45 ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaa 144  Q
    |||||||||| |||||||||  || || ||| |||| ||| ||||||| ||| |||||||||| ||| | ||||||||||      | ||||||||||||    
249416 ggggaataccaggttcgattctcagggagaataacgcttgaccagtgcacatacctctacgcacgagtcggattagtcgc------tgggtgggtcggaa 249323  T
145 actggtgcgaaagcc 159  Q
    || ||||||||||||    
249322 accggtgcgaaagcc 249308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 68 - 158
Target Start/End: Complemental strand, 65240 - 65150
Alignment:
68 aaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||||| |||||||||||||||| ||||||||||||||  |||||||||||||| |||| | | |||||||| |||||||||||    
65240 aaggggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaagc 65150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 5 - 121
Target Start/End: Original strand, 18589 - 18706
Alignment:
5 ttgggctccagtggcaaggaactccttccaagaacgtaccggg-gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctcta 103  Q
    |||| ||||||||||||||| ||||||||||| | ||||| |  ||| ||||||||||||| | | ||||||||||| ||||||||||| |||| |||||    
18589 ttggactccagtggcaaggagctccttccaaggatgtacccgaagaacaccgggttcgattcctagggggaacaacgcttggccagtgcacatgtctcta 18688  T
104 cgcatgagccagattagt 121  Q
    |||| |||||||||||||    
18689 cgcacgagccagattagt 18706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 74 - 157
Target Start/End: Original strand, 16906 - 16989
Alignment:
74 aacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    ||||||| |||| ||||||| ||| ||||||||| ||||||||||||||||||||||||||||||| |||||| | ||||||||    
16906 aacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 26 - 104
Target Start/End: Original strand, 8153 - 8231
Alignment:
26 ctccttccaagaacgtacc-ggggaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctac 104  Q
    ||||||||||| ||||||| |||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||||||    
8153 ctccttccaaggacgtacccggggaataccgggttcgattcccaaggg-aacaacgcttggccagtgcgcatgcctctac 8231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0332 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0332
Description:

Target: scaffold0332; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 15284 - 15352
Alignment:
1 ttgtttgggctccagtggcaaggaactccttccaagaacgtacc-ggggaataccgggttcgatttcca 68  Q
    |||||||||||| ||||||||||| |||||| |||| | ||||| ||||||||||||||||||||||||    
15284 ttgtttgggctctagtggcaaggagctccttacaaggaagtacccggggaataccgggttcgatttcca 15352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 69 - 157
Target Start/End: Original strand, 25107 - 25195
Alignment:
69 aggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||||||||  |||| |||||||||||  |||||||||||  ||||||| |||  |||||||||||| |||||||| ||||||||||    
25107 aggggaacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag 25195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 48 - 156
Target Start/End: Original strand, 186519 - 186626
Alignment:
48 gaataccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaact 147  Q
    ||||| ||||||||||||| | || ||| || | |||| |||||| |||||||||||||| ||||| ||||||||| ||| |||| |||||||||||||     
186519 gaatatcgggttcgatttc-agggagaataatgtttggtcagtgcacatgcctctacgcacgagccggattagtcgttcatctttagtgggtcggaaacc 186617  T
148 ggtgcgaaa 156  Q
    |||| ||||    
186618 ggtgtgaaa 186626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 87 - 157
Target Start/End: Original strand, 224357 - 224427
Alignment:
87 cagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 157  Q
    |||||| ||| |||||||||| ||||| |||||||||  || |||||||||||||||||| ||||||||||    
224357 cagtgcacatacctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 149408 - 149496
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 158  Q
    ||||||||||| ||| |||||| ||||||||||||| | |||  ||||||||||| ||||  ||||||||| ||||| ||||| |||||    
149408 ggggaacaacgcttgaccagtgtgcatgcctctacgtacgaggtagattagtcgcccaccaatggtgggtcagaaaccggtgcaaaagc 149496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0155 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0155
Description:

Target: scaffold0155; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 70 - 156
Target Start/End: Original strand, 19278 - 19364
Alignment:
70 ggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggtgcgaaa 156  Q
    ||||||||||| ||||| ||||||||  |||||||||||||||| |||||||||  ||   || |||| |||||||| |||||||||    
19278 ggggaacaacgcttggctagtgcgcagacctctacgcatgagccggattagtcggccattattagtggatcggaaaccggtgcgaaa 19364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 51 - 157
Target Start/End: Original strand, 51735 - 51837
Alignment:
51 taccgggttcgatttccaaggggaacaacgattggccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaactggt 150  Q
    |||||||||||||| |||  |||||||||| |||||||||||||||| ||    ||| ||||| ||| |||||| |||||||| ||| || ||||| |||    
51735 taccgggttcgattcccagagggaacaacgcttggccagtgcgcatgtct----gcacgagccggatcagtcgcccacctttgatggatctgaaaccggt 51830  T
151 gcgaaag 157  Q
    | |||||    
51831 gtgaaag 51837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 86 - 146
Target Start/End: Original strand, 17429 - 17489
Alignment:
86 ccagtgcgcatgcctctacgcatgagccagattagtcgctcacctttggtgggtcggaaac 146  Q
    ||||||||||||| ||||| || ||||| |||||||||| |||| ||| ||||||||||||    
17429 ccagtgcgcatgcttctacacacgagccggattagtcgcccaccattgatgggtcggaaac 17489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University