View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_low_29 (Length: 354)
Name: NF18161_low_29
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 25039558 - 25039472
Alignment:
| Q |
1 |
atcggtatttgaaagaaactatctagtagcaagtgtgtatttaccccgacagataaatccagtaggatttcttgcgacttgaatacc |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
25039558 |
atcggtatttgaaagaaactatctagtagcaagtgtgtatttaccctgacagataaatgcagtaggatttcttgcgacttcaatacc |
25039472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 110 - 267
Target Start/End: Complemental strand, 20641565 - 20641411
Alignment:
| Q |
110 |
agatctttcatatgaaaacaagtgctaaggcagaacttaaagcgcctgattatggcacaaggcttattacaagcaataattgaatcatcaacataaacaa |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||| |||||||||| ||||| ||| |||| |||||| ||||| ||| ||||||| || ||||| | |
|
|
| T |
20641565 |
agatctttcatatgaaaacatttgctgaggtagagcttaaagcgcttgatt---gcagaaggagtattacctgcaattattaaatcatcgacgtaaacga |
20641469 |
T |
 |
| Q |
210 |
gaaccacaaggtaggtgtcttcttagctcaaagtaaacaaggaataatcaagatatga |
267 |
Q |
| |
|
|||| ||||| | | || |||||| | || ||| ||||| ||||||||||||||||| |
|
|
| T |
20641468 |
gaactacaagttggctgccttcttggtgcagagtgaacaaagaataatcaagatatga |
20641411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 110 - 219
Target Start/End: Complemental strand, 52795498 - 52795392
Alignment:
| Q |
110 |
agatctttcatatgaaaacaagtgctaaggcagaacttaaagcgcctgattatggcacaaggcttattacaagcaataattgaatcatcaacataaacaa |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||| |||||||||||||||| ||| |||| |||||| ||||| ||| ||||||| || ||||||| |
|
|
| T |
52795498 |
agatctttcatatgaaaacatttgctgaggtagagcttaaagcgcctgatt---gcagaaggagtattacctgcaattattaaatcatcgacgtaaacaa |
52795402 |
T |
 |
| Q |
210 |
gaaccacaag |
219 |
Q |
| |
|
|||| ||||| |
|
|
| T |
52795401 |
gaactacaag |
52795392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University