View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18161_low_30 (Length: 334)

Name: NF18161_low_30
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18161_low_30
NF18161_low_30
[»] chr2 (2 HSPs)
chr2 (15-151)||(43108616-43108752)
chr2 (237-316)||(43108455-43108534)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 15 - 151
Target Start/End: Complemental strand, 43108752 - 43108616
Alignment:
15 caaaggtaaggaggggttatagatgcaaatgatgacaaagaagccgattttatgacacgacaactttttaagaatgagtagtgatacattgatcatccat 114  Q
    |||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||    
43108752 caaaggtaaggaggagttatagatgcaaatgatgacaaagaagctgattttacgacacaacaactttttaagaatgagtagtgatacattaatcatccat 43108653  T
115 gcggtaaactctccattctatacttcaatgtgacatt 151  Q
    |||||||||||| ||||||| ||||||||||||||||    
43108652 gcggtaaactcttcattctacacttcaatgtgacatt 43108616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 237 - 316
Target Start/End: Complemental strand, 43108534 - 43108455
Alignment:
237 atatgaaatatgattatgagnnnnnnntggtgtcggtccataattatcctttaaaaatcagcaaagaaaattgaagatta 316  Q
    ||||||||||||||||||||       || |||| ||| ||||||||||||||||||||| |||||||||||||||||||    
43108534 atatgaaatatgattatgagaaaaaaatgatgtcagtctataattatcctttaaaaatcaacaaagaaaattgaagatta 43108455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University