View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_low_41 (Length: 267)
Name: NF18161_low_41
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_low_41 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 267
Target Start/End: Original strand, 41620026 - 41620271
Alignment:
| Q |
18 |
aaaagggatctcaaaacaatagtaatattgttcaacagtgcaacacctcaattttcctagagtcttgcttatgaatcatgatcgatggttattgtgttta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
41620026 |
aaaagggatctcaaaacaatagtaatattgttcgacaatgcaacacctcaattttcctatagtcttgcttatga-------tcgatggttattgtgttta |
41620118 |
T |
|
| Q |
118 |
tgatgattttgagctatgggattaagtgtaggatatattcaatgagcttacaaacctctttagaatgagatagcatttta-acaaatcgatgtgaagc-- |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
41620119 |
tgatgattttgagctatgggattaagtgtaggatatattcaatgagcttacaaacctctttagaatgagatagccttttacacaaatcaatgtgaagcga |
41620218 |
T |
|
| Q |
215 |
tctctacatcattctatcgatatatgaagctataactttcatgactcagagtt |
267 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| || ||| |||||| |
|
|
| T |
41620219 |
tctctacattattctatcgatatacgaagctataacttttataacttagagtt |
41620271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University