View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18161_low_44 (Length: 253)
Name: NF18161_low_44
Description: NF18161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18161_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 40745854 - 40746069
Alignment:
| Q |
18 |
aataacacaatctaataactctcagtctcaactagaaagaatataacaatacaaatcaaatatcaaccatagttatcactcttagagagacaatcaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40745854 |
aataacacaatctaataactctcagtctcaacta-aaagaatataacaatacaaatcaaatatcaaccatagttatcactcttagagagacaatcaaact |
40745952 |
T |
|
| Q |
118 |
aactagatttgattgatttacaacaagatgacgagctctcaatgagaaaggatatacactgaatatctcgtgttctaggcctgattgactgcccgccttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40745953 |
aactagatttgattgatttacaacaagatgacgagctctcaatgagaaaggatatacactgaatatctcgtgttctaggcctgattgactgcccgccttc |
40746052 |
T |
|
| Q |
218 |
attacagtattttcttt |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40746053 |
attacagtattttcttt |
40746069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University