View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_high_23 (Length: 337)
Name: NF18162_high_23
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 319
Target Start/End: Original strand, 34176894 - 34177195
Alignment:
| Q |
19 |
tcttcagatacaagaggaaaacatagaatacatgctgagcttaaaaggttggaacaggaaacaaggtacttagaggtagctacttcatcttcacctttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34176894 |
tcttcagatacaagaggaaaacatagaatacatgctgagcttaaaaggttggaacaagaaacaaggtacttagaggtagctacttcatcttcacctttac |
34176993 |
T |
|
| Q |
119 |
catgttttgaagttttgttctttattgggtggnnnnnnn-atcaaaggaatttatgagtatggtagtttgatcttttgatcatgttggtattgttggaaa |
217 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34176994 |
catgttttcaagttttgttctttactgggtggttttttttatcaaaggaatttatgagtatggtagtttgatcttttgatcatgttggtattgttggaaa |
34177093 |
T |
|
| Q |
218 |
caaatgttatctgtgaaattgatcatgttgcctcctatgctatgctggatagtaaatttgannnnnnngtttctatgaaatggatttatgaatatggttt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34177094 |
caaatgttatctgtgaaattgatcatgttgcctcctatgctatgctggatagtaaatttgatttttttgtttctatgaaatggatttatgaatatggttt |
34177193 |
T |
|
| Q |
318 |
ag |
319 |
Q |
| |
|
|| |
|
|
| T |
34177194 |
ag |
34177195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 19 - 141
Target Start/End: Original strand, 34147524 - 34147652
Alignment:
| Q |
19 |
tcttcagatacaagaggaaaacatagaatacatgctgagcttaaaaggttggaacaggaaacaaggtacttagaggtag------ctacttcatcttcac |
112 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |||||| |||||||||| |||||||||||| ||||||| | ||||||| |||||| |
|
|
| T |
34147524 |
tcttcagatacaagagggaaacataggatacatgctgaacttaaacggttggaacaagaaacaaggtacctagaggttggtacttctacttcttcttcat |
34147623 |
T |
|
| Q |
113 |
ctttaccatgttttgaagttttgttcttt |
141 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
34147624 |
ctttaccatgttttctagttttgttcttt |
34147652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University