View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_high_29 (Length: 291)
Name: NF18162_high_29
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 5791985 - 5791897
Alignment:
| Q |
186 |
ggtaactaaaatttgatttcgtttgnnnnnnncata-ttttcttcaaacatatcaataataacagttttgaacaattcaattcggtttg |
273 |
Q |
| |
|
||||||||||||| ||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5791985 |
ggtaactaaaattcgatttcgtttgtttttttcatattttttttcaaacatatcaataataacagttttgaacaattcaattcggtttg |
5791897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 49
Target Start/End: Complemental strand, 5792158 - 5792119
Alignment:
| Q |
10 |
attatacttcacatcacatgacatgattacctgggtggat |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5792158 |
attatacttcacatcacatgacatgattacctgggtggat |
5792119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University