View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_high_31 (Length: 287)
Name: NF18162_high_31
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 117 - 269
Target Start/End: Original strand, 10661356 - 10661508
Alignment:
| Q |
117 |
ccatttcttgagtgctgttgccaatctttcattaaaaatggttggtttcatggttgaacccatctgtaatatcaagccaaaaacaatatgaaagtgttaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10661356 |
ccatttcttgagtgctgttgccaatctttcattaaaaatggttggtttcatggttgaacccatctgtaatatcaagccaaaaacaatatgaaagtgttaa |
10661455 |
T |
 |
| Q |
217 |
atagttttctttttctcttaacactttggtcgcgcgattagactcctgataat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
10661456 |
atagttttctttttctcttaacactttggtcgcacgattagactcttgataat |
10661508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University