View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_high_36 (Length: 248)
Name: NF18162_high_36
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 220
Target Start/End: Complemental strand, 39004052 - 39003841
Alignment:
| Q |
7 |
taactagtagtatttgtagtaattagaaggaatgatgaatagcagaaaaagtttatggtgagtgagagatgatgatgagaggaaggaaaattgcgcagca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
39004052 |
taactagtagtatttgtagtaattagaaggaatgatgaatagcagaaaaagtttatggtgagtgagagatgatgatgagaggaaggaagattgcgcagta |
39003953 |
T |
|
| Q |
107 |
gtacttattgaagtaattgtaatgataaaatgggcgcagagtccacagaacagcatagccacttgtaaaattgggtctgttccccactttcaacacgttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39003952 |
gtacttattgaagtaattgtaatgataaaatgggcgcagagtccacagaacagcatagccacttgtaaaattgggtctgtt--ccactttcaacacgttg |
39003855 |
T |
|
| Q |
207 |
ttttgattgaagat |
220 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39003854 |
ttttgattgaagat |
39003841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University