View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18162_high_44 (Length: 222)

Name: NF18162_high_44
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18162_high_44
NF18162_high_44
[»] chr7 (1 HSPs)
chr7 (99-207)||(21892977-21893084)
[»] chr3 (1 HSPs)
chr3 (152-204)||(41046641-41046693)
[»] chr6 (1 HSPs)
chr6 (162-205)||(34870368-34870411)


Alignment Details
Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 99 - 207
Target Start/End: Complemental strand, 21893084 - 21892977
Alignment:
99 aactatgctaattagagtacatctacttactacacactatacaagnnnnnnnncttccaccaatttttccaattttgcccttgatttaggggcattttag 198  Q
    |||||||||||||| ||||||||||||||||| ||||||||||||        |||||| ||||||||||||||| |||||||||||||||||| |||||    
21893084 aactatgctaattaaagtacatctacttactatacactatacaagaaaaaaa-cttccatcaatttttccaatttagcccttgatttaggggcactttag 21892986  T
199 tcatttctt 207  Q
    |||||||||    
21892985 tcatttctt 21892977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 204
Target Start/End: Original strand, 41046641 - 41046693
Alignment:
152 cttccaccaatttttccaattttgcccttgatttaggggcattttagtcattt 204  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
41046641 cttccaccaatttttccaaatttacccttgatttaggggcattttagtcattt 41046693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 205
Target Start/End: Original strand, 34870368 - 34870411
Alignment:
162 tttttccaattttgcccttgatttaggggcattttagtcatttc 205  Q
    ||||||||||||||||| |||||||||||||||||  |||||||    
34870368 tttttccaattttgcccatgatttaggggcattttcatcatttc 34870411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University