View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_high_46 (Length: 208)
Name: NF18162_high_46
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 191
Target Start/End: Complemental strand, 8537085 - 8536903
Alignment:
| Q |
9 |
gtgagaagaatgaagaaacatatgtgtttgtgaacatgttgaagaagcttgagagcatcactgaatctactttgggcatgaaaagaaatggttaggttga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8537085 |
gtgacaagaatgaagaaacatatgtgtttgtgaacatgttgaagaagcttgagagcatcactgaatctactttgggcatgaaaaaaaatggttaggttga |
8536986 |
T |
|
| Q |
109 |
ttaagatactgattcagttatagttagtagttttttaccaattttctttgcatccgtttctataactgtggacctacttattt |
191 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8536985 |
ttaagatactgttttagttatagttagtagttttttaccaattttctttgcatccgtttctataactgtggacctacttattt |
8536903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University