View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_low_12 (Length: 448)
Name: NF18162_low_12
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 53789496 - 53789373
Alignment:
| Q |
11 |
gaacctgtgtttagcgttggaatttcatgaaaataaaacggcgcataagatcagataagataacgacagggagatgtattagggtttttgttttcttctt |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53789496 |
gaacctgagtttagcgttggaatttcatgacaataaaacggcgcataagatcagataagataaagacagggagatgtattagggtttttgttttcttctt |
53789397 |
T |
|
| Q |
111 |
gtgaaaaaagatgtattagggttt |
134 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
53789396 |
gtgagaaaagatgtattagggttt |
53789373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 350 - 433
Target Start/End: Complemental strand, 53789223 - 53789140
Alignment:
| Q |
350 |
tgttagttactttagtccttaacatttccaaaagtggtaactgttgcaaaatgaagaagaaaaaacattcattcttcttcatca |
433 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53789223 |
tgttagttactttagtccttaacattttcaaaagtggtaactgttgcaaaatgaagaagaaaaaacattaattcttcttcatca |
53789140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 53789284 - 53789236
Alignment:
| Q |
225 |
ttgatgaaatttgaaatgggcaaaccattacattgatccctaaaatgtc |
273 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53789284 |
ttgatgaaatttgaaatgggcaaaccactacattgatccctaaaatgtc |
53789236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 168 - 207
Target Start/End: Complemental strand, 53789310 - 53789271
Alignment:
| Q |
168 |
taatggtcaataattattattaataattgatgaaatttga |
207 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53789310 |
taatggtcaataattatgattaataattgatgaaatttga |
53789271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University