View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_low_23 (Length: 338)
Name: NF18162_low_23
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 3 - 323
Target Start/End: Original strand, 24991170 - 24991487
Alignment:
| Q |
3 |
gatgtcgaataatatgagttgcaaaatgatgttaaatcaaatgaatctccaaatgaagaagcataaaatttttagagtctttt-gaaagatacaaataaa |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
24991170 |
gatgtcgaatatgatgagttgcaaaatgatgttaaatcaaatgaatctccaaatgaagaagcataaattttttagagtctttttgaaagatacaattaaa |
24991269 |
T |
|
| Q |
102 |
tcattgtttgaaggatcttcgaactcaaagtcaacaatgtgtgttagacatttatgtatgaattctcaatttcatgtttttgaattggctggtgaccaaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24991270 |
tcattgtttgaaggatcttcgaactcaaagtcaacaatgtgtgttagacatttatgtatgaattctcaatttcatgtttttgaattggctggtgaccaaa |
24991369 |
T |
|
| Q |
202 |
atgatgttggatgcaacacctataattgtcaatttgtctaaaatttacttataattagtgttgaagctaggactaattaagggtggaagatcaattaaat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24991370 |
atgatgttggatgcaacacctataattgtcaatttgtctcaaatttacttataattagtgtcgaagctaggactaat----ggtggaagatcaattaaat |
24991465 |
T |
|
| Q |
302 |
gttgtgttattggcaacaaatt |
323 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
24991466 |
gttgtgttaatggcaacaaatt |
24991487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University