View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_low_36 (Length: 272)
Name: NF18162_low_36
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_low_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 272
Target Start/End: Complemental strand, 3640035 - 3639773
Alignment:
| Q |
10 |
caagatcaattcttttctaaatataaccaggccccccaccccacaaactgaaagccccgaaagaaccacaagccgataacacggtaacaaccgtcgactc |
109 |
Q |
| |
|
|||||||||| ||||||| ||||||| || || ||| || || |||||| |||| ||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3640035 |
caagatcaatccttttctcaatataatcatgcacccaacaccccaaactcaaagacccgatagaagcacaagccgataacacggtaacaaccgtcgactc |
3639936 |
T |
 |
| Q |
110 |
atttggctcagcttctccacttacaaccatttgtttaaaaacctcaacagcctcaccacattgtcctccacgtgcataagccattaacaatgtagtccaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639935 |
atttggctcagcttctccacttacaatcatttgtttaaaaacctcaacagcctcaccacattgtcctccacgtgcataagccattaacaatgtagtccaa |
3639836 |
T |
 |
| Q |
210 |
gaaataacatcccttttagacattttcacaaacacattccgtgcattactcaagaacccacat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3639835 |
gaaataacatcccttttagacattttcacaaacacattccgtgcattactaaaaaacccacat |
3639773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University