View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_low_44 (Length: 227)
Name: NF18162_low_44
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 208
Target Start/End: Original strand, 12613247 - 12613443
Alignment:
| Q |
12 |
gagaagaacaatgagagcgttaagagttgactagtttattttggaataaagaaatgaagcataatgaaagttaagtctatggttacattgccacataact |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12613247 |
gagaagagcaatgagagcgttaagagttgactagtttattttggaataaagaaatgaagcataatgaaagctaagtctatggttacattgccacataact |
12613346 |
T |
 |
| Q |
112 |
gcatatatttaatacagatagatacattagaacatataaagacttacaactgtttttgtcttttgaatatgataaagaaatggttttgagaacagac |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12613347 |
gcatatatttaatacagattgatacattagaacatataaagacttacaactgtttttgtcttttgaatatgataaagaaatggttttgagaacagac |
12613443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University