View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18162_low_46 (Length: 222)
Name: NF18162_low_46
Description: NF18162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18162_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 99 - 207
Target Start/End: Complemental strand, 21893084 - 21892977
Alignment:
| Q |
99 |
aactatgctaattagagtacatctacttactacacactatacaagnnnnnnnncttccaccaatttttccaattttgcccttgatttaggggcattttag |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |||||| ||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
21893084 |
aactatgctaattaaagtacatctacttactatacactatacaagaaaaaaa-cttccatcaatttttccaatttagcccttgatttaggggcactttag |
21892986 |
T |
|
| Q |
199 |
tcatttctt |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
21892985 |
tcatttctt |
21892977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 152 - 204
Target Start/End: Original strand, 41046641 - 41046693
Alignment:
| Q |
152 |
cttccaccaatttttccaattttgcccttgatttaggggcattttagtcattt |
204 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
41046641 |
cttccaccaatttttccaaatttacccttgatttaggggcattttagtcattt |
41046693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 205
Target Start/End: Original strand, 34870368 - 34870411
Alignment:
| Q |
162 |
tttttccaattttgcccttgatttaggggcattttagtcatttc |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
34870368 |
tttttccaattttgcccatgatttaggggcattttcatcatttc |
34870411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University