View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_high_19 (Length: 262)
Name: NF18163_high_19
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_high_19 |
 |  |
|
| [»] scaffold0856 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 4009 - 3824
Alignment:
| Q |
1 |
tttgataacttgtccctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaatacaaggcattagcagaccttgcagcacatgtatcttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
4009 |
tttgataacttgtccctctagaaaataaaaagttgtgtcaagatctaggcagaatcagaatacaagacattagcagaccttgcagcacatgtagcttgaa |
3910 |
T |
 |
| Q |
101 |
tccggtctatattataggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaaaatttgagtgctaagcttttgcttc |
186 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909 |
tccgatctatattataggaaataaagttgaaatacctcaaacaagtgtattgtggtgtgaaaatttgagtgctaagcttttgcttc |
3824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0856; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 220 - 262
Target Start/End: Complemental strand, 3817 - 3775
Alignment:
| Q |
220 |
agaagtggatgtgcactatatcagagatcagttgttgagtaat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3817 |
agaagtggatgtgcactatatcagagatcagttgttgagtaat |
3775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University