View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_high_25 (Length: 238)
Name: NF18163_high_25
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_high_25 |
 | |
|
| [»] scaffold0223 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0223 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 20858 - 20639
Alignment:
| Q |
16 |
atgcattcaagctaggcatgcttacatgacttttgtggttaaaaatcaaagcctatgagctagcttcatgcacaaatttggaaaatctgcaactttatac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20858 |
atgcattcaagctaggcatgcttacatgacttttgtggttaaaaatcaaagcctatgagctagcttcatgcacaaatttggaaaatctgcaactttatac |
20759 |
T |
|
| Q |
116 |
cctcattt-gttattatagttttcttatatatgtattgatgttagaatagttactgaaaatgtcctttttaaatcttcttatgatgatattttcatgaaa |
214 |
Q |
| |
|
| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20758 |
tcccattttgttattatagctttcttatatatgtattgatgttagaatagttactgaaaatgtcctttttaaatcttcttatgatgatattttcatgaaa |
20659 |
T |
|
| Q |
215 |
ctttttagtatctaatatga |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
20658 |
ctttttagtatctaatatga |
20639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University