View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_low_14 (Length: 300)
Name: NF18163_low_14
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 3 - 131
Target Start/End: Complemental strand, 19395823 - 19395695
Alignment:
| Q |
3 |
tatgaaatgtcagcattttctaagcttagtggcagtggagaaatctgacttgaaagaggtatatgattaacgtatatagcctttataagtttatatatct |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19395823 |
tatgaaatgtcagcattttctaagcttagtggtagtggagaaatctgacttgaaagaggtatatgattaacgtatatagcctttataagtttatatatct |
19395724 |
T |
|
| Q |
103 |
gtatgttatcattggatttcaatgttata |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19395723 |
gtatgttatcattggatttcaatgttata |
19395695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 160 - 281
Target Start/End: Complemental strand, 19390218 - 19390094
Alignment:
| Q |
160 |
taaaaatgatttagggtgaagcttgttcctcttactgattctgtctacttaga---actattagagttgttgccgatgactttgctcctactcattattg |
256 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19390218 |
taaagatgatttagggtgaagcttgttcctcttactgattctgactacttagagaaactattagagttgttgccgatgactttgctcctactcattattg |
19390119 |
T |
|
| Q |
257 |
tatcggcatcatccattgggaccat |
281 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19390118 |
catcggcatcatccattgggaccat |
19390094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 131 - 165
Target Start/End: Complemental strand, 19391331 - 19391297
Alignment:
| Q |
131 |
atggaagtttttgtgaaccctcaatttagtaaaaa |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19391331 |
atggaagtttttgtgaaccctcaatttagtaaaaa |
19391297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University