View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_low_20 (Length: 267)
Name: NF18163_low_20
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 97 - 251
Target Start/End: Complemental strand, 1715243 - 1715072
Alignment:
| Q |
97 |
tcgctcgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatatttcggaacaggtgagtagcaaatttc |
196 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1715243 |
tcgcttgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatattttggaacaggtgagtagcaaatttc |
1715144 |
T |
|
| Q |
197 |
ccagccaa-----------------caattccgcattgcatctctttcattctatgttcgtttgctttaact |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715143 |
ccagccaacactattttcatattctcaattccgcattgcatctctttcattctatgttcgtttgctttaact |
1715072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 12 - 98
Target Start/End: Complemental strand, 1715358 - 1715272
Alignment:
| Q |
12 |
tcatcatttaaatgaccaacaagaatacgaccttccaactttagctccattggatggttgtgtgcctcatacacaacaccgagactc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1715358 |
tcatcatttaaatgaccaacaagaatacgaccttccaactttagctccattggatggttgtgtgcctcatacacaacaccgagactc |
1715272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 96 - 195
Target Start/End: Complemental strand, 30018324 - 30018228
Alignment:
| Q |
96 |
ctcgctcgtatctctccgacagccgccgtagccgctgccgtgattcattctctcatttcatcttatctgcgatatttcggaacaggtgagtagcaaattt |
195 |
Q |
| |
|
||||||||||||||||||| ||| |||| ||||| |||| |||| ||||| ||||||||||| |||||| |||||| ||||||||||||| |||||| |
|
|
| T |
30018324 |
ctcgctcgtatctctccgatcgccaccgtcgccgc---cgtgcttcactctcttatttcatcttagctgcgacatttcgtaacaggtgagtagaaaattt |
30018228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University