View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_low_23 (Length: 258)
Name: NF18163_low_23
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 30463378 - 30463603
Alignment:
| Q |
19 |
cacacttccaaacgaaacatataaaaacaaaatctttttccaactctttttactcccccaaaattgtggttgacatcaaatctccttctctacatactct |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30463378 |
cacacttccaaacgaaacacataaaaacaaaatctttttccaactctttttactcccccaaaattgtggttgacatcaaatctccttctctacatactct |
30463477 |
T |
|
| Q |
119 |
cttggcaccacttccaaaaatggcaacataaatcatatcattgctacaatttcttcactcaccaaacactccattatttgaacacacgttctctctatcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30463478 |
cttggcaccacttccaaaaatggcaacataaatcatatcattgctacaatttcttcactcaccaaactctccattatttgaacacacgttctctctatcc |
30463577 |
T |
|
| Q |
219 |
ttcacaaaactatcttacaatataaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30463578 |
ttcacaaaactatcttacaatataaa |
30463603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University