View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_low_26 (Length: 249)
Name: NF18163_low_26
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_low_26 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 20326 - 20565
Alignment:
| Q |
12 |
tatactacttttaagtcctttgaaaagtttgaaattatttctaaagaagaaaataaagctatggtgacctttttggggagaaatttctgtagctaaagag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20326 |
tatactacttttaagtcctttgaaaagtttgaaattatttctaaagaagaaaataaagctatggtgacctttttggggagaaatttctgtagctaaagag |
20425 |
T |
 |
| Q |
112 |
agaatcagattccattccaagagattcatgatcaccaaatccatcatcatcatgctcctgaaaagattgttttttatgtacggaactagtcctatctgtc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20426 |
agaatcagattccattccaagagattcatgatcaccaaatccatcatcatcatgctcctgaaaagattgttttttatgtacggaagtagtcctatctgtc |
20525 |
T |
 |
| Q |
212 |
acatataaaccaacac--attaaggaaattagattggtaa |
249 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20526 |
aaatataaaccaacacatattaaggaaattagattggtaa |
20565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University