View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18163_low_31 (Length: 208)
Name: NF18163_low_31
Description: NF18163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18163_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 3 - 191
Target Start/End: Complemental strand, 39703531 - 39703343
Alignment:
| Q |
3 |
aatagttgctcattccactattctatctcaactgctacaactatagtcaaaattatgagcactattaaatatttgcccactaccaccactatataacacg |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39703531 |
aatagttgctcactccactattctatctcaactgctacaactatagtcaaaattatgagcactattaaatatttgcccactaccaccactatataacacg |
39703432 |
T |
|
| Q |
103 |
tgatactgatgatactctcttgtgctaattttagcctcaatttaaaaagcaatcatcactgtaatgctttttacaccaccagtaccaag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39703431 |
tgatactgatgatactctcttgtgctaattttagcctcaatttaaaaagcaatcatcactgtaatgctttttacaccaccagtaccaag |
39703343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University