View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18164_low_10 (Length: 306)
Name: NF18164_low_10
Description: NF18164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18164_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 9959801 - 9960094
Alignment:
| Q |
1 |
ctgtaataacgatgcctatgtttcaaatataatcaagcattactattctccatgaaatcnnnnnnngttcacctcagtgtaccataaatttgtttaatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
9959801 |
ctgtaataacgatgcctatgtttcaaatataatcaagcattactattctccatgaaatcaaaaaaagttcacctcagtgtaccataaatttgcttaatgg |
9959900 |
T |
|
| Q |
101 |
ttgccttcatacacttttttcttttatctgaaatgagatgacaggatcaacattttgtccaacaaagttttctttctaacctccaagaggaaagcaagtg |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9959901 |
ttgctttcatacacttttttcttttatctgagatgagatgacaggatcaacattttgtccaacaaagttttctttctaacctccaagaggaaagcaagtg |
9960000 |
T |
|
| Q |
201 |
tccaaccttaataattggtcgtgataatacttatttccctttcggctagcactagttcatgtaacccctcagtacttttttaccttctcattctttt |
297 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
9960001 |
tccaacctcaataattg---gtaataatacttatttccctttcggctagcactagttcatgtaactcctcaatacttttttagcttctcattctttt |
9960094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University