View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18164_low_13 (Length: 210)

Name: NF18164_low_13
Description: NF18164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18164_low_13
NF18164_low_13
[»] chr4 (1 HSPs)
chr4 (19-201)||(45185633-45185820)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 45185633 - 45185820
Alignment:
19 ctagtatactagccaaatgcacaacaacaatgacatagatgtaatgaaatatggtataaatgcaatttgttaaacaagt-aatcaaaattctgaaattgt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
45185633 ctagtatactagccaaatgcacaacaacaatgacatagatgtaatgaaatatggtataaatgcaatttgttaaacaagtaaatcaaaattctgaaattgt 45185732  T
118 aatgaaacat----nnnnnnntaaatgaaatgcaatattaaaagtaatgaattgagtttaaacgaaccccttctttctccatgatgat 201  Q
    ||||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45185733 aatgaaacataaaaaaaaaaaaaaatgaaatgcaatattaaaagtaatgaattgagtttaaacgaaccccttctttctccatgatgat 45185820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University