View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_high_11 (Length: 270)
Name: NF18166_high_11
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 41 - 254
Target Start/End: Original strand, 13765748 - 13765961
Alignment:
| Q |
41 |
ggctaagggaagggatcttgttgtggtggaggtagctaataagaaccagtgtttggcgtatttgtggactattttgaagatctaagactcgtagatgttc |
140 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||| ||||||||||||||||||| ||||||| ||| |||||| |||| |||||||| |||||||| |
|
|
| T |
13765748 |
ggctaaggggagggatcttgtttttgtggaggtagctgataagaaccagtgtttggcctatttgtaaactgttttgacgatccaagactcgcagatgttc |
13765847 |
T |
|
| Q |
141 |
caatggtcaagagcaaaatggttgagagagagaaggacataatacaacttatttccacgcctgtgtgaagaatagaggtatgaggaattccatctcggca |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13765848 |
caatggtcaagagcaaagtggttgagagagagaaggacataatacaacttatttcctcgcctgtgtgaagaatagaggtatgaggaattccatctcggct |
13765947 |
T |
|
| Q |
241 |
cctagggtggaaag |
254 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
13765948 |
cctagggtggaaag |
13765961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University