View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_high_13 (Length: 252)
Name: NF18166_high_13
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 38835033 - 38834822
Alignment:
| Q |
16 |
cattttattacttataaaagaagatcatgaagatttttccgatcaaatatgctagatatggtagaaattaagcaaaaacatttgtatttaggtgaagtgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38835033 |
cattttattacttataaaagaagatcatgaagatttttccgatcaaatatgctagatatggtagaaattaagcaaaaacatttgtatttaggtgaagtgg |
38834934 |
T |
|
| Q |
116 |
gttttaagcacaataacaaggaaatggtaacttgaggtgtgtagagatactttgaatcgtgataaggatagtttgtctcactagtttgtggcatacacac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38834933 |
gttttaagcacaataacaaggaaatggtaacttgaggtgtgtagagatactttgaatcgtgataaggatagtttgtctcactagtttgtggcatacacac |
38834834 |
T |
|
| Q |
216 |
aatgtagacccc |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38834833 |
aatgtagacccc |
38834822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University