View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_high_17 (Length: 235)
Name: NF18166_high_17
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33588019 - 33588234
Alignment:
| Q |
1 |
ctaacatatttggcttgatgtggaattgattataataattctatgattcaatcattgctctgactctggaagtggatatggttttatcgtttttctacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33588019 |
ctaacatatttggcttgatgtggaattgattataa---ttctatgattcaatcattactctgactctggaagtggatatggttttatcgtttttctacta |
33588115 |
T |
 |
| Q |
101 |
atattgttgtgacccaaaaaaggaatgggtagcgaagtgagttatcatgcaaacaacggcattg-ttgtcatgtacatgatccgtcaagtgtgagtaaac |
199 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33588116 |
ata---ttgtgacccaaaaaaagaatgggtagcgaagtgagttatcatgcaaacaacggcactgtttgtcatgtacatgatccgtcaagtgtgagtaaac |
33588212 |
T |
 |
| Q |
200 |
atatttttatttaacaaatttc |
221 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
33588213 |
atatttttatttaaaaaatttc |
33588234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University