View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_high_18 (Length: 222)
Name: NF18166_high_18
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_high_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 16398948 - 16399133
Alignment:
| Q |
16 |
attatactacattgagattatagtagctcaaaatgatatttctaatttcaatgacnnnnnnngtcttctacaagttagcaatcttattctttttaacatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16398948 |
attatactacattgagattatagtagctcaaaatgatatttctaatttcaatgacaaaaaaagtcttctacaagttagcaatcttattctttttaacatt |
16399047 |
T |
|
| Q |
116 |
tgattgggaaatttgaaatgctaggtttactgtaagagaattgatgttagaacatgttttttatgagaatctaactcaaaattttg |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16399048 |
tgattgggaaattttaaatgctaggtttactgtaagagatttgatgttagaacatgttttttatgagaatctaactcaaaattttg |
16399133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 200
Target Start/End: Complemental strand, 14309313 - 14309265
Alignment:
| Q |
152 |
agaattgatgttagaacatgttttttatgagaatctaactcaaaatttt |
200 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
14309313 |
agaattgattgtaggacatgtttttcatgagaatctaactcaaaatttt |
14309265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University