View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_low_10 (Length: 328)
Name: NF18166_low_10
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 6 - 314
Target Start/End: Complemental strand, 28537616 - 28537308
Alignment:
| Q |
6 |
tggtgatggtaataataatgagagagaaaatactatatcatcttctgaagctaagaagcttatgagattggtgaatgttgaaacacttaagatggaactt |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28537616 |
tggtaatggtaataataatgagagagaaaatactatatcatcttctgaggctaagaagcttatgagattggtgaatgttgaaacacttaagatggaactt |
28537517 |
T |
|
| Q |
106 |
ggtatgggagggaaagaaattatttcctattttgaacttcttcaagcttgtcagagtagtggtattgctaggaatcaagatgaggctgcaaaatttgcta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28537516 |
ggtatgggagggaaagaaattatttcctattttgaacttcttcaagcttgtcagagtagtggtattgctaggaatcaagatgaggctgcaaaatttgcta |
28537417 |
T |
|
| Q |
206 |
aggttcttgatgatgctggggttgttctactatttagggataaggtttatctgcatcctgataaggtgagctttacttgtttcaatagtcattttttcat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28537416 |
aggttcttgatgatgctggggttgttctactatttagggataaggtttatctgcatcctgataaggtgagctttacttgtttcaatagtcattttttcat |
28537317 |
T |
|
| Q |
306 |
tgttttgtt |
314 |
Q |
| |
|
||||||||| |
|
|
| T |
28537316 |
tgttttgtt |
28537308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 49 - 272
Target Start/End: Complemental strand, 32397194 - 32396971
Alignment:
| Q |
49 |
tctgaagctaagaagcttatgagattggtgaatgttgaaacacttaagatggaacttggtatgggagggaaagaaattatttcctattttgaacttcttc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | || |||||| |||||||||||| || |||||| ||||||| ||| ||||||| || |
|
|
| T |
32397194 |
tctgaagctaagaagcttatgagattggtgaatgtggaatctctaaagatgaaacttggtatggatggaaaagaagttatttcttataatgaacttattg |
32397095 |
T |
|
| Q |
149 |
aagcttgtcagagtagtggtattgctaggaatcaagatgaggctgcaaaatttgctaaggttcttgatgatgctggggttgttctactatttagggataa |
248 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||| || |||||||| || |||||||||||||||||| ||||| ||| |||| || || |||||||| |
|
|
| T |
32397094 |
aagcttgtgagagtatgggtgttgctaggaattctgaagaggctgctgcatatgctaaggttcttgatgaagctggtgttattcttctcttcagggataa |
32396995 |
T |
|
| Q |
249 |
ggtttatctgcatcctgataaggt |
272 |
Q |
| |
|
||| ||||| |||||||||||||| |
|
|
| T |
32396994 |
ggtctatcttcatcctgataaggt |
32396971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University