View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_low_12 (Length: 273)
Name: NF18166_low_12
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 33 - 260
Target Start/End: Complemental strand, 34365197 - 34364970
Alignment:
| Q |
33 |
acgtttccaccatcagattctgattgagttagaactcttgtcatcagaaaccttcatttttattttatgatggatgatattattcttagggaagtgtcac |
132 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34365197 |
acgtatccacaatcagattctgattgagttagaactcttgtcttcagaaaccttcattttt-ttttatgatggatgatattattcttagggaagtgtcac |
34365099 |
T |
|
| Q |
133 |
acaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagttaacactgagcctaatctagacagacaagggtttgatgat-ggaatgtcaaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34365098 |
acaacttgtggaataactgaatatatgacaaaatgcttgtaggtcagttaacactgagcctaatctagacagacaggggtttgatgatgggaatgtcaaa |
34364999 |
T |
|
| Q |
232 |
actcaaaatttcaatcctccattatagta |
260 |
Q |
| |
|
|||||| ||||||||| ||||||| |||| |
|
|
| T |
34364998 |
actcaatatttcaatcttccattagagta |
34364970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University