View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_low_18 (Length: 242)
Name: NF18166_low_18
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_low_18 |
 | |
|
| [»] scaffold0380 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0380 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0380
Description:
Target: scaffold0380; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 116 - 155
Alignment:
| Q |
130 |
tatgtgaaaaatggagtagatttgagtggttgtttggtat |
169 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
116 |
tatgtgagaaatggagtagatttgagtggttgtttggtat |
155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0380; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 206 - 240
Target Start/End: Original strand, 192 - 226
Alignment:
| Q |
206 |
ttacttattttgaaaagtactataatgcccctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
192 |
ttacttattttgaaaagtactataatgcccctatg |
226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 169
Target Start/End: Original strand, 29109306 - 29109345
Alignment:
| Q |
130 |
tatgtgaaaaatggagtagatttgagtggttgtttggtat |
169 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29109306 |
tatgtgagaaatggagtagatttgagtggttgtttggtat |
29109345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 210 - 240
Target Start/End: Original strand, 29109386 - 29109416
Alignment:
| Q |
210 |
ttattttgaaaagtactataatgcccctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29109386 |
ttattttgaaaagtactataatgcccctatg |
29109416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 33587948 - 33587920
Alignment:
| Q |
1 |
cgatcacgtgttggttggtatactgtctc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33587948 |
cgatcacgtgttggttggtatactgtctc |
33587920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University