View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18166_low_19 (Length: 239)
Name: NF18166_low_19
Description: NF18166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18166_low_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 8552653 - 8552431
Alignment:
| Q |
17 |
aacaagcagttacatgaattaattaatgatctcattcatcaatgtaagatagatccattcatattagagattgatcaaatcataataagttcatccttag |
116 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8552653 |
aacaagcagttacatgaattaattaatcatctcattcatcaatgtaagatagatccattcatattagagattcatcaaatcataataagttcatccttag |
8552554 |
T |
|
| Q |
117 |
gttgatttgagatgaataaatgagtgactagagtattaatttgatttattgatggttatagcacgtgagtgagttataaataagtactgtagacagagat |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8552553 |
gttgatttgagatgaataaatgagtcactagagtattaatttgatttattaatggttatagcacgtgagtgagttataaataagtactgtagacagagat |
8552454 |
T |
|
| Q |
217 |
ttaggtggggaccaatgaagcca |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8552453 |
ttaggtggggaccaatgaagcca |
8552431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University