View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18167_low_5 (Length: 217)
Name: NF18167_low_5
Description: NF18167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18167_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Original strand, 37092067 - 37092256
Alignment:
| Q |
14 |
atcatagtcgttgtttagtttcccgatcagtgggagtgtttgatcagacggctgataacgatccaagctcaaaccagctgaaacatgttcttgtgattgt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37092067 |
atcatagccgttgtttagtttcccgatcagtgggagtgtttgatcagacggctgataacgatccaagctcaaaccagctgaaacatgttcttgtgattgt |
37092166 |
T |
|
| Q |
114 |
gaagaacaaggttttggtccatcaccttgttgcaccaccaccggtgactggttaatcaggtggggatctgagagatgcaaaggtgaaaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37092167 |
gaagaacaaggttttggtccatcaccttgttgcaccaccaccggtgactggttaatcaggtggggatctgagagatgcaaaggtgaaaga |
37092256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 22 - 203
Target Start/End: Original strand, 37098342 - 37098532
Alignment:
| Q |
22 |
cgttgtttagtttcccgatcagtgggagtgtttgatcagacggctgataacgatccaagctcaaaccagctgaaacatgttcttgtgattg--------- |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||| |||| | |
|
|
| T |
37098342 |
cgttgtttagtttcccgatcagtgggagtgtttgatcagacggttgataatgatccaagctcaaaccagctgaagcatgttctcgtgacagcaccggagt |
37098441 |
T |
|
| Q |
113 |
tgaagaacaaggttttggtccatcaccttgttgcaccaccaccggtgactggttaatcaggtggggatctgagagatgcaaaggtgaaaga |
203 |
Q |
| |
|
|||||||| || |||||||| ||||| |||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37098442 |
ggaagaacagggctttggtccttcaccaagttgcaccaccatcggtgacttgttcatcaggtggggatctgagagattcaaaggtgaaaga |
37098532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University