View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_high_21 (Length: 307)
Name: NF18168_high_21
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_high_21 |
 |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 21 - 289
Target Start/End: Complemental strand, 10484863 - 10484594
Alignment:
| Q |
21 |
cctcagccacagtgttta-tgtttttagtggatacccttttgattatatgttttgctacttgaggtatccactatcaccagaacctccaccatcatttgt |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484863 |
cctcagccacagtgtttaatgtttttagtggatactcttttgattatatgttttgctacttgaggtatccactatcaccagaacctccaccatcatttgt |
10484764 |
T |
 |
| Q |
120 |
cctattgaccctgtagttactatgttcaacaatggacaccctttttctgatgttctttcaaaaatatgatacattgttttactattgcacgtgcatcact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10484763 |
cctattgaccctgtagttactatgttcaacaatggacaccctttttctgatgttctttcaaaaatatgatacattgttttactattgcacgtgcatcact |
10484664 |
T |
 |
| Q |
220 |
cccttgggcctacaaaagacaaaagtttctatatgcggctacttcatttttgggacatttcttatgtttc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10484663 |
cccttgggcctacaaaagacaaaagtttctatatgcggctacttcattttggggacatttcttatgtttc |
10484594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 38 - 215
Target Start/End: Original strand, 4951046 - 4951235
Alignment:
| Q |
38 |
atgtttttagtggatacccttttgatt----atatgttttgctacttgaggtatccact------atcaccagaacctccaccatcatttgtcctattga |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
4951046 |
atgtttttagtggatacccttttgattcattatatgttttgctacttgaggtatccactatcactatcaccagaacctccaccatcatttgtcatattgg |
4951145 |
T |
 |
| Q |
128 |
ccct---gtagttactatgttcaacaatggacaccctttttctgatgttctttcaaaa-atatgatacattgttttactattgcacgtgcat |
215 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4951146 |
ccctgtagtagttactcttttcaacaatggacaccctttt--ggatgttctttcaaaacatatgatacattgttttactattgcacgtgcat |
4951235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 38 - 118
Target Start/End: Complemental strand, 223815 - 223735
Alignment:
| Q |
38 |
atgtttttagtggatacccttttgattatatgttttgctacttgaggtatccactatcaccagaacctccaccatcatttg |
118 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
223815 |
atgtttttagtggatacacttttgattgtatgttttgctacttgaggtatccactatcaccaaaacctccaccatcatttg |
223735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University