View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_high_25 (Length: 276)
Name: NF18168_high_25
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 8402967 - 8402721
Alignment:
| Q |
18 |
tccaaacctatatatacatgcatgaatttacattttgagtttttagtatgaatgattcattggtactatttcacannnnnnnatgcttttcttcttagtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8402967 |
tccaaacctatatatacatgcatgaatttacattttgagtttttagtatgaatgattcattggtactatttcacatttttttatgcttttcttcttagtt |
8402868 |
T |
 |
| Q |
118 |
ggggctaggggtgagaataaaatgtaatttgtataacattgtaagttttgcagctttatgctccggaaagaattgattctattactcttcccttggacct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402867 |
ggggctaggggtgagaataaaatgtaatttgtataacattgtaagttttgcagctttatgctccagaaagaattgattctattactcttcccttggacct |
8402768 |
T |
 |
| Q |
218 |
tggtatttgttggtcatgaacgcttcgcatatatctctatgtatttt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8402767 |
tggtatttgttggtcatgaacgcttcgcatatatctctatgtatttt |
8402721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University