View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_high_29 (Length: 238)
Name: NF18168_high_29
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 27756122 - 27756338
Alignment:
| Q |
17 |
agatgtatagtcaatactttgattgttctgttgagattagaaataaattctgccttgcagatggatcttggagttggagcatttgttttagcaaattcac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27756122 |
agatgtatagtcaatactttgattgttctgttgagattagaaattacttctgccttgcagatggatcttggagttggagcatttgttttagcaaattcac |
27756221 |
T |
 |
| Q |
117 |
tagtttctcggcaagcacggaatgttgcttctgtgtaagtatgtctacacaatgaactattagaaattagttgtgttagtactatgtttactgaaataga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27756222 |
tagtttctcggcaagcacggaatgttgcttctgtgtaagtatgtctacacaatgaactcttagaaattagttgtgttag---tatgtttactgaaataga |
27756318 |
T |
 |
| Q |
217 |
ataatcatgtttacttagat |
236 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
27756319 |
ataatcacatttacttagat |
27756338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University