View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_high_33 (Length: 217)
Name: NF18168_high_33
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 96570 - 96465
Alignment:
| Q |
14 |
caaaggcaggttaaaaaactgacctcaacaattcgaagttcattcaagagtgactcagatggaactgtaattgtctgtattatatgggaacgctgaaata |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
96570 |
caaaggcaggttaaaaaactgacctcaacaattcgaagttcattcaagagtgactcagatggaactgtaattgtctgtattatatgggaacgctgaaata |
96471 |
T |
 |
| Q |
114 |
acgtag |
119 |
Q |
| |
|
|||||| |
|
|
| T |
96470 |
acgtag |
96465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University