View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_low_12 (Length: 421)
Name: NF18168_low_12
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 370; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 8 - 406
Target Start/End: Complemental strand, 46851040 - 46850646
Alignment:
| Q |
8 |
cagaacctgtggctgagatggtttacttgcattgcagactattatgtagataatatgccagtaataacttaactttatgtttaattaagctgggtaaaat |
107 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46851040 |
cagaaactgtagctgagatggtttacttgcattgcagactattatgtagataatatgccagtaataacttatctttatgtttaattaagctgggtaaaat |
46850941 |
T |
|
| Q |
108 |
gtaatatgggtttaaaccttatggtcttcggatgatatatattatgtatgtacttgcagacttctattgcctattgggttatatttactatggtttaagt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46850940 |
gtaatatgggtttaaaccttatggtcttcggatgatatatattatgta----cttgcagacttctattgcctattgggttatatttactatggtttaagt |
46850845 |
T |
|
| Q |
208 |
tatctgtgttgtgcaatattttatgcctgcctgcaaatctatgattcccttagcagtcaactctcatggtcttttaccccatcagagaatagaaggaatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46850844 |
tatctgtgttgtgcaatattttatgcctgcctgcaaatctatgattcccttagcagtcaactctcatggtcttttaccccatcagagaatagaaggaatt |
46850745 |
T |
|
| Q |
308 |
tcatgtttgtttatttgagactcttgaagccccccaacggctatttcagtgcttattttatttgatgaaaatccattactacagagtaactatattgct |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46850744 |
tcatgtttgtttatttgagactcttgaagccccccaacggctatttcagtgcttattttatttgatgaaaatccattactacagagtaactatattgct |
46850646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University