View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18168_low_32 (Length: 244)
Name: NF18168_low_32
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18168_low_32 |
 | |
|
| [»] scaffold0280 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0280 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 1466 - 1600
Alignment:
| Q |
16 |
atgtgttgtgattgatatcgaaagcatttgttgatcgtcatacgatcccccnnnnnnnnnctacaaagcaatttcagggatcatatgaacagttggcagc |
115 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||| ||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
1466 |
atgtgttgtgattgatatcaaaagtatttgttgaccgtcatacgatcccccaaaaaaaaactacaaagcgaattcagggatcatatgaacagttggcagc |
1565 |
T |
|
| Q |
116 |
gaccatgatatcataattcattaaacacccctaac |
150 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1566 |
gaccatgatatcataattcataaaacacccctaac |
1600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 80 - 137
Target Start/End: Original strand, 5529551 - 5529608
Alignment:
| Q |
80 |
aaagcaatttcagggatcatatgaacagttggcagcgaccatgatatcataattcatt |
137 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||| || ||||||||||||| ||||| |
|
|
| T |
5529551 |
aaagaaatttcagggatcatatgaatagtcagcagtgatcatgatatcataaatcatt |
5529608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University