View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18168_low_33 (Length: 238)

Name: NF18168_low_33
Description: NF18168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18168_low_33
NF18168_low_33
[»] chr8 (1 HSPs)
chr8 (17-236)||(27756122-27756338)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 27756122 - 27756338
Alignment:
17 agatgtatagtcaatactttgattgttctgttgagattagaaataaattctgccttgcagatggatcttggagttggagcatttgttttagcaaattcac 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||    
27756122 agatgtatagtcaatactttgattgttctgttgagattagaaattacttctgccttgcagatggatcttggagttggagcatttgttttagcaaattcac 27756221  T
117 tagtttctcggcaagcacggaatgttgcttctgtgtaagtatgtctacacaatgaactattagaaattagttgtgttagtactatgtttactgaaataga 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||   ||||||||||||||||||    
27756222 tagtttctcggcaagcacggaatgttgcttctgtgtaagtatgtctacacaatgaactcttagaaattagttgtgttag---tatgtttactgaaataga 27756318  T
217 ataatcatgtttacttagat 236  Q
    |||||||  |||||||||||    
27756319 ataatcacatttacttagat 27756338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University