View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18169_low_2 (Length: 357)
Name: NF18169_low_2
Description: NF18169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18169_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 23 - 345
Target Start/End: Original strand, 48763661 - 48763983
Alignment:
| Q |
23 |
ggtggttcactaccgctctcatcatcaatatcctcctcaagaagttgagcagccagagcatacttcttcttccaaaaccaaacctcatcccgatgaacaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48763661 |
ggtggttcactaccgctctcatcatcaatatcctcctcaagaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaa |
48763760 |
T |
|
| Q |
123 |
cctcgccacaaaattttgaaacaggtcaaccaacttgcctaatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatct |
222 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763761 |
cctcatcacaaaattttgaaacaggtcaaccaacttgcctaatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatct |
48763860 |
T |
|
| Q |
223 |
attcgtgttgatcatatctctctaaattgcatctctacaacttgactagggttttggttgggatcttttaggtggagtattatttcagtgatttaaactt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48763861 |
attcgtgttgatcatatctctctaaattgcatctctacaacttgactagggttttggttgggattttttaggtggagtattatttcagcgatttaaactt |
48763960 |
T |
|
| Q |
323 |
ggctaccaccgatcatttgatga |
345 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48763961 |
ggctaccaccgatcatttgatga |
48763983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University